ID: 968550730

View in Genome Browser
Species Human (GRCh38)
Location 4:1222390-1222412
Sequence CAAGATCACCACAGACAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 247}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968550721_968550730 16 Left 968550721 4:1222351-1222373 CCCGAGGCCGAGGGAGCGCTGAC 0: 1
1: 0
2: 0
3: 7
4: 144
Right 968550730 4:1222390-1222412 CAAGATCACCACAGACAGAGGGG 0: 1
1: 0
2: 0
3: 24
4: 247
968550726_968550730 -6 Left 968550726 4:1222373-1222395 CCTGGCCTGGTTCATCACAAGAT 0: 1
1: 0
2: 3
3: 13
4: 123
Right 968550730 4:1222390-1222412 CAAGATCACCACAGACAGAGGGG 0: 1
1: 0
2: 0
3: 24
4: 247
968550722_968550730 15 Left 968550722 4:1222352-1222374 CCGAGGCCGAGGGAGCGCTGACC 0: 1
1: 0
2: 0
3: 8
4: 159
Right 968550730 4:1222390-1222412 CAAGATCACCACAGACAGAGGGG 0: 1
1: 0
2: 0
3: 24
4: 247
968550724_968550730 9 Left 968550724 4:1222358-1222380 CCGAGGGAGCGCTGACCTGGCCT 0: 1
1: 0
2: 0
3: 23
4: 187
Right 968550730 4:1222390-1222412 CAAGATCACCACAGACAGAGGGG 0: 1
1: 0
2: 0
3: 24
4: 247
968550720_968550730 24 Left 968550720 4:1222343-1222365 CCTCAGCTCCCGAGGCCGAGGGA 0: 1
1: 0
2: 1
3: 7
4: 199
Right 968550730 4:1222390-1222412 CAAGATCACCACAGACAGAGGGG 0: 1
1: 0
2: 0
3: 24
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968550730 Original CRISPR CAAGATCACCACAGACAGAG GGG Intronic
900281854 1:1874906-1874928 CAATTTTTCCACAGACAGAGGGG + Intronic
901425238 1:9178529-9178551 CATGATCACCACAAGGAGAGTGG - Intergenic
904201736 1:28824207-28824229 AAAGAACACCACACAGAGAGAGG + Intronic
904420016 1:30385302-30385324 CTGGCTCAGCACAGACAGAGAGG - Intergenic
905504331 1:38465255-38465277 CAATACCACCACCTACAGAGTGG - Intergenic
907614212 1:55907332-55907354 CAATTTTTCCACAGACAGAGTGG - Intergenic
908297134 1:62723947-62723969 CAATATTACCACAAACTGAGGGG - Intergenic
908495452 1:64689746-64689768 CAGGATGACCACAGCCATAGAGG - Intronic
908859013 1:68462289-68462311 CAAAATCTCAAAAGACAGAGTGG - Intergenic
908932499 1:69333842-69333864 CAAGAACACCAAAAACAGACAGG - Intergenic
910641127 1:89463454-89463476 CTAGATGACCATAGCCAGAGAGG + Intergenic
912059236 1:105644259-105644281 CAAAATCACCAAAGAAATAGTGG + Intergenic
912557357 1:110525684-110525706 CAGCTTCACCACAGACAGAGGGG - Intergenic
913050089 1:115109855-115109877 CAAGAGCACTGCAGGCAGAGGGG - Intergenic
915063192 1:153203508-153203530 CAAGTTCACCACCAACACAGAGG + Exonic
915263195 1:154694431-154694453 GAAGACCACCAAAGGCAGAGGGG - Intergenic
915296416 1:154924827-154924849 CAAGGCCACCACAGGCTGAGGGG + Exonic
915399368 1:155611222-155611244 GAAGCTCACCACACACAAAGAGG + Exonic
915416482 1:155746802-155746824 GAAGCTCACCACACACAAAGAGG + Intergenic
915939904 1:160112420-160112442 CAAGATCATGAAAGAGAGAGAGG - Intergenic
916346032 1:163792424-163792446 TAAAATTACCACAGACTGAGTGG + Intergenic
916488653 1:165281584-165281606 CAGGCTGACCACAGGCAGAGAGG + Intronic
916583066 1:166125589-166125611 CCAATCCACCACAGACAGAGAGG - Intronic
919521253 1:198591320-198591342 CAAAGTCACCCCAGCCAGAGTGG + Intergenic
920575143 1:207053659-207053681 CAAGGTCACCTCAGGAAGAGGGG - Intronic
922728454 1:227937512-227937534 CAAGATCATCCCAGACATGGTGG + Intronic
922790227 1:228307154-228307176 GCAGCTCACCACGGACAGAGAGG - Exonic
924175030 1:241382494-241382516 CAAGCTAACCACAAAAAGAGAGG + Intergenic
1062872891 10:922051-922073 CAATTTTTCCACAGACAGAGCGG + Intronic
1063135018 10:3208732-3208754 CATGCTCACCACACACACAGAGG - Intergenic
1070850428 10:79558503-79558525 CAGGAGCCCCACAGACAGAGGGG - Intronic
1070856790 10:79612793-79612815 CAGGAGCCCCACAGACAGAGGGG + Intronic
1072535918 10:96362652-96362674 ACAGAGCACCACAGACTGAGTGG + Intergenic
1073319076 10:102603053-102603075 CCAGGTGACCTCAGACAGAGAGG - Intronic
1073773274 10:106758857-106758879 CAAGAGCACCAGAGGGAGAGAGG + Intronic
1074881742 10:117664992-117665014 CCAGCTCACCAGAGACAGATTGG - Intergenic
1075632458 10:124009163-124009185 CAAGATCATCAGAGAAACAGAGG - Exonic
1076712488 10:132346111-132346133 CATGAGCACCCCAGACAGAGAGG + Intronic
1077421281 11:2451197-2451219 CAAGATCACCACTGCCCGGGTGG - Intronic
1078503708 11:11911494-11911516 GAAAATTACCACAGACAGAGAGG + Intronic
1079484469 11:20920676-20920698 CACAATCACCTGAGACAGAGTGG - Intronic
1080877005 11:36284277-36284299 GAAAATTACCAGAGACAGAGAGG + Intronic
1082654426 11:55836147-55836169 CAAGCTCTCCAGAGGCAGAGGGG + Intergenic
1083332739 11:61906474-61906496 CACCCTCACCCCAGACAGAGAGG - Exonic
1086139013 11:83473815-83473837 CCACAGCACCACAGAAAGAGAGG + Intronic
1086562018 11:88178731-88178753 CAAGAGCACCACTGCCAAAGAGG + Intergenic
1086735069 11:90296281-90296303 AAAGATCAACACAGACATAATGG - Intergenic
1087621554 11:100548751-100548773 CAAAAACACCACAGACTGGGGGG + Intergenic
1087629854 11:100637195-100637217 TAAGAGTACCACAGACAGGGTGG - Intergenic
1088981713 11:114870583-114870605 CAGGATCACAGCAGACAGACTGG + Intergenic
1089007555 11:115105219-115105241 CAAGAGGAGCACACACAGAGAGG + Intergenic
1089876997 11:121733120-121733142 GAAAATTACCAGAGACAGAGGGG - Intergenic
1090664642 11:128906361-128906383 ACAGATGACCACAGACATAGTGG + Intronic
1090842512 11:130504284-130504306 GAAAATTACCAGAGACAGAGAGG - Intergenic
1090944832 11:131420486-131420508 ACAGATCACCACAGACGTAGTGG - Intronic
1091364194 11:135004050-135004072 CAGGGTCACCACAAACAGAAGGG + Intergenic
1091914942 12:4264790-4264812 CAATATCCCCACAGACACTGAGG + Intergenic
1092857902 12:12692328-12692350 CAAGATGACCACTCAAAGAGAGG - Intronic
1095901930 12:47336567-47336589 AAAAATTACCAGAGACAGAGAGG - Intergenic
1096147438 12:49288977-49288999 CAGGGTCCCCACTGACAGAGTGG - Intergenic
1096350515 12:50895537-50895559 GAAGATCACTAAAGACAAAGAGG + Intergenic
1096607883 12:52779675-52779697 CAAGGTCACCACATAGTGAGAGG - Intergenic
1097669392 12:62517744-62517766 CAAGATAACCAGAGACTGGGTGG - Intronic
1098089133 12:66882352-66882374 CAAGATCACCAGAGAAAAACTGG + Intergenic
1100924726 12:99531891-99531913 CAAGATCACCCTAGTCAGAATGG - Intronic
1100984876 12:100194280-100194302 CAAAAACACCACAGACTGAGTGG + Intergenic
1102077886 12:110074292-110074314 CAAGATCACCAGGGACCAAGTGG + Intergenic
1103464593 12:121132231-121132253 AAAGATCACCAGGGACACAGTGG - Intergenic
1104011082 12:124930628-124930650 ACAGATCACCACAAACTGAGTGG + Intergenic
1104709176 12:130973273-130973295 CAAGATCCCCACAAACAGGTCGG - Intronic
1104922190 12:132296226-132296248 ACAGATCACCACAGACTGCGTGG - Intronic
1106127016 13:26909004-26909026 CAAGAGCACCACAGCCAGAATGG + Intergenic
1106394980 13:29370912-29370934 CAAGATTACCGCAGATAAAGAGG + Intronic
1108010297 13:46000242-46000264 CAAGATGTCCATAGCCAGAGAGG - Intronic
1108594083 13:51935610-51935632 TGAGAGCACCACAGACACAGAGG + Exonic
1109208791 13:59511122-59511144 CAAGATCACCAGATTCACAGTGG + Intergenic
1110364713 13:74669184-74669206 CAAGCCCACCACAGACCCAGAGG + Intergenic
1112030023 13:95448505-95448527 CAAGATTTTCACAGACAGTGAGG + Intronic
1112459128 13:99587751-99587773 AAAGGACACCATAGACAGAGTGG - Intergenic
1113822672 13:113226215-113226237 CAACATCCTCACACACAGAGAGG - Intronic
1114544085 14:23485694-23485716 GAAGATCAGCACAGAGAGAATGG - Intronic
1115712414 14:36065564-36065586 CATGATTAATACAGACAGAGTGG - Intergenic
1119427269 14:74543890-74543912 CAAAGTCACCACAAACAGTGAGG + Intronic
1119671384 14:76521494-76521516 GAAAATTACCAGAGACAGAGAGG - Intergenic
1120204470 14:81573098-81573120 CAATTTCACCACATATAGAGAGG - Intergenic
1121065991 14:90965506-90965528 CCTGATCATCTCAGACAGAGAGG + Intronic
1121476166 14:94206217-94206239 GAAAATCACCAGAGACAGACAGG - Intronic
1122238856 14:100348604-100348626 CAAGAACACCGCAGGCAGGGAGG + Intronic
1122542027 14:102504058-102504080 CAAGGTCACCTCAGAGAGATGGG + Exonic
1123736239 15:23186872-23186894 AAAAATCACAAAAGACAGAGGGG - Intergenic
1123799436 15:23804919-23804941 CAAGGCCACCACAGCAAGAGAGG + Intergenic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1124286945 15:28409845-28409867 AAAAATCACAAAAGACAGAGGGG - Intergenic
1124295756 15:28501782-28501804 AAAAATCACAAAAGACAGAGGGG + Intergenic
1124370033 15:29099259-29099281 CAAGACCACCACAGGCTGGGTGG + Intronic
1127894542 15:63284565-63284587 CAACATCACCACAAACACGGGGG + Intronic
1128042406 15:64586655-64586677 CAATTTTTCCACAGACAGAGGGG - Intronic
1128130308 15:65222935-65222957 CAGGTTCACCAAATACAGAGAGG - Intergenic
1129751965 15:78071829-78071851 CAAAAACACCACAGACTAAGTGG + Intronic
1132426370 15:101721193-101721215 CAACATCATCACAGTAAGAGTGG - Exonic
1133144047 16:3770542-3770564 CAAAAACAGCAGAGACAGAGAGG + Intronic
1135713965 16:24744751-24744773 AAAGAGGACAACAGACAGAGTGG - Intronic
1137791401 16:51177635-51177657 GAAGAACACAACACACAGAGAGG - Intergenic
1144130085 17:12238427-12238449 CAAGGTCCCCCCACACAGAGTGG + Intergenic
1144743419 17:17597112-17597134 CAAGATCACCCAACTCAGAGTGG - Intergenic
1145761993 17:27430383-27430405 CAAGGCCACGAGAGACAGAGAGG + Intergenic
1147177955 17:38668524-38668546 CAGGTTCTCCATAGACAGAGGGG + Intergenic
1147877919 17:43634688-43634710 CAAGATGAGCACAGACTCAGTGG + Intergenic
1148210495 17:45805713-45805735 CCAGCTCCCCACAGCCAGAGGGG + Intronic
1152145677 17:78567310-78567332 AAAGAACAGCACAGACACAGAGG - Intronic
1152322529 17:79615947-79615969 CCAAATCATCACAGACAGAAAGG + Intergenic
1154110804 18:11566822-11566844 CGAGAGCACAGCAGACAGAGGGG + Intergenic
1154281584 18:13007900-13007922 GCAGCTCACCACAGAAAGAGAGG - Intronic
1155210490 18:23596367-23596389 CAAGCTCATCAAAGACAGAGTGG + Intergenic
1155272183 18:24151371-24151393 CCAGATCACCAAAGTCATAGTGG + Intronic
1155888210 18:31234094-31234116 CAATATCACCACCAACAGAAAGG + Intergenic
1156756956 18:40539375-40539397 CAAGGTAGCCTCAGACAGAGAGG + Intergenic
1157901821 18:51525521-51525543 CAGGAAGACCACAGACAGAGAGG - Intergenic
1158846747 18:61451965-61451987 TAAGACCACAACAGACAGAAAGG - Intronic
1162014078 19:7834573-7834595 CAGGATCACCACAGAAAGGGAGG + Intronic
1164507390 19:28870972-28870994 CAGGACCAACACAGAAAGAGCGG - Intergenic
1165182360 19:33983258-33983280 GAAAATAACCAGAGACAGAGAGG + Intergenic
1168330266 19:55563998-55564020 GCAGATCACGAGAGACAGAGGGG - Intergenic
924986341 2:273547-273569 CTAGAGCAGCACAGCCAGAGCGG + Intronic
925186443 2:1849936-1849958 CCAGATCCCAACAGTCAGAGTGG - Intronic
925810866 2:7699101-7699123 CAAGATGAAAACTGACAGAGAGG - Intergenic
926782214 2:16483671-16483693 CATCAGCTCCACAGACAGAGAGG + Intergenic
929349459 2:40931365-40931387 CAAGGTCACTGCACACAGAGAGG - Intergenic
929470062 2:42182723-42182745 CAAAATTACCACAGACTGGGTGG + Intronic
934131811 2:88955834-88955856 CCACATCACCCCAGTCAGAGGGG - Intergenic
934133325 2:88970473-88970495 CCACATCACCCCAGTCAGAGGGG - Intergenic
934136083 2:88997655-88997677 CCACATCACCCCAGTCAGAGGGG - Intergenic
934181004 2:89620528-89620550 GAAGAGCACCCCAGACAGTGAGG - Intergenic
934220247 2:90075636-90075658 CCACATCACCCCAGTCAGAGGGG + Intergenic
934681810 2:96289226-96289248 CAAGAACATCACAGTGAGAGAGG - Exonic
935067860 2:99666790-99666812 GAAAATGACCAGAGACAGAGTGG + Intronic
935757142 2:106285018-106285040 TGAGATCACCACAGCCAGTGAGG - Intergenic
937284920 2:120744316-120744338 CTTGATCTCCACAGACAGCGAGG - Intronic
938447403 2:131389560-131389582 CAAGATGACGACAGGAAGAGAGG - Intergenic
939449777 2:142358532-142358554 AAAAATCACCACAGACATAATGG - Intergenic
940380084 2:153004741-153004763 CAAGATCAGTAGAGACAGAGAGG - Intergenic
941499038 2:166246033-166246055 CAAAAACACCAGAGACATAGGGG - Intronic
942537741 2:176983129-176983151 CAGCTTCTCCACAGACAGAGGGG - Intergenic
945141529 2:206691805-206691827 CAAAATGACCACAGAAATAGGGG + Intronic
945213315 2:207406863-207406885 ATAGAACACCACAGACTGAGTGG + Intergenic
945564744 2:211383537-211383559 GAAGACCACCAGAGAAAGAGAGG + Exonic
945660852 2:212683497-212683519 GAAGATCATTCCAGACAGAGGGG - Intergenic
946228490 2:218277509-218277531 CAAAATCACCACTTCCAGAGGGG + Intronic
946238939 2:218342131-218342153 GAAACTCACCACAGCCAGAGAGG - Exonic
947257886 2:228185532-228185554 GAAAATTACCAGAGACAGAGAGG + Intergenic
1168960505 20:1866093-1866115 CAAGATCACCAAAACAAGAGTGG + Intergenic
1169608568 20:7352293-7352315 CAAGATTACCTCAGAGAGTGTGG - Intergenic
1171358454 20:24568381-24568403 CATGCTCACGACAGACAGATGGG - Intronic
1178010191 21:28275981-28276003 AAAGATCACCATAGACTGGGTGG + Intergenic
1181166944 22:20988992-20989014 CAAGAAACCCCCAGACAGAGTGG - Intronic
1181886309 22:26024837-26024859 CAAGAACACCATAGACTGGGTGG + Intronic
1182355759 22:29721595-29721617 CAAGACCAGCACAGTCAGGGAGG + Intronic
1182647464 22:31822002-31822024 CAAAATCACAAAAGTCAGAGAGG - Intronic
1183800847 22:40163306-40163328 CAAGATCACCTGAGCCTGAGAGG + Intronic
1183814885 22:40291403-40291425 CAAGATAACCACACACAGTTTGG + Intronic
1184588603 22:45464997-45465019 GAAAATTACCAGAGACAGAGAGG + Intergenic
949228623 3:1724140-1724162 CAAGAGCACCAGAGACACAGAGG + Intergenic
950542569 3:13621067-13621089 CATGAGCAGCACAGGCAGAGGGG - Intronic
950837895 3:15938174-15938196 CTAGATCACCACCCATAGAGTGG + Intergenic
950860312 3:16141974-16141996 CAAAAATACCACAGACTGAGTGG + Intergenic
952715930 3:36481072-36481094 CAAGAGATCCACAGACTGAGGGG + Intronic
952871004 3:37901323-37901345 GAAGAACAGCACAGACACAGAGG - Intronic
954389787 3:50262677-50262699 CAAGATCACCAGGGACTGTGGGG - Intergenic
954992063 3:54850004-54850026 CAAGAACAGCTCAGACATAGGGG + Intronic
955133829 3:56196326-56196348 CAAGATCACAAAAGATATAGTGG - Intronic
956107412 3:65834836-65834858 TAAAATTACCAGAGACAGAGAGG - Intronic
957150527 3:76480494-76480516 CAAGAATACCACAAACTGAGAGG + Intronic
957346359 3:78966202-78966224 CAATTTTTCCACAGACAGAGAGG - Intronic
961595443 3:128012269-128012291 CAGCATCACCACACACAGAGAGG - Intergenic
961723664 3:128911927-128911949 GAAGAGCACTGCAGACAGAGCGG - Intronic
962218079 3:133540102-133540124 CAAAATCCCCAGAGGCAGAGGGG - Intergenic
962713657 3:138108676-138108698 TAAGATCACAAGAGACCGAGGGG - Intronic
962891067 3:139673529-139673551 CAGTATCACTATAGACAGAGGGG - Intronic
963824613 3:149938533-149938555 AAAAATCATCACAGATAGAGAGG - Intronic
963964471 3:151350184-151350206 GAAGAGCACCACAGAGACAGGGG + Exonic
965144884 3:164889221-164889243 GCAGATCACCATAGAGAGAGAGG - Intergenic
966159169 3:176949994-176950016 ACAGATTACCACAGACTGAGTGG + Intergenic
966683492 3:182668573-182668595 GAAGATCAACATAGACAGACAGG - Intergenic
966855502 3:184191216-184191238 CGAGATCAGCAGACACAGAGAGG - Exonic
968345189 3:197998159-197998181 CAAGACCACAATAGACAGATGGG + Intronic
968550730 4:1222390-1222412 CAAGATCACCACAGACAGAGGGG + Intronic
970114773 4:12682390-12682412 CAAAATTACCATAGACTGAGTGG - Intergenic
970248759 4:14092342-14092364 CAAAATTACCACAGACTGAGTGG + Intergenic
970430247 4:15982613-15982635 ACAGATCACCAGGGACAGAGGGG - Intronic
974884263 4:67797284-67797306 GAAAATCACCAGAGACAGAGAGG - Intergenic
976072238 4:81254610-81254632 ACAGAACACCACAGACTGAGTGG - Intergenic
976072311 4:81255931-81255953 CAACCTCACCACAGGGAGAGAGG + Intergenic
976565742 4:86548757-86548779 CAAAATCACCAGGGTCAGAGTGG - Intronic
978419072 4:108510983-108511005 AAATATCACTACAAACAGAGAGG - Intergenic
980806795 4:137826007-137826029 CAAGAACTTCACAGACAGAATGG + Intergenic
981008716 4:139902535-139902557 GAAGATACCCACAGACAGACAGG + Intronic
981874391 4:149522967-149522989 CAAAAATACCACAGACTGAGTGG + Intergenic
982235332 4:153246874-153246896 CAAGGCCACCAGAGGCAGAGGGG - Intronic
983615365 4:169698431-169698453 CTAGAAAACCACAGAGAGAGAGG - Intronic
986761448 5:10883324-10883346 CCAGAACACCAGAGACAGGGAGG + Intergenic
986784338 5:11098357-11098379 GAAGATCACTACAAACAGAGAGG - Intronic
987816462 5:22907269-22907291 ACAGAACACCACAGACTGAGTGG + Intergenic
990224735 5:53636758-53636780 CAAGAACAGCACAGACAGGATGG - Intronic
991946744 5:71905508-71905530 CAATATCACCACAAACTCAGTGG + Intergenic
992553640 5:77882941-77882963 CATGATCAGCACAGGCAGAAAGG - Intergenic
993031000 5:82705685-82705707 CATGAGCATCACAGTCAGAGAGG - Intergenic
993677554 5:90835402-90835424 GAAGTTCAGCACAGACACAGAGG - Intronic
993768007 5:91886840-91886862 CAGGATTACCGCAGCCAGAGTGG - Intergenic
995881032 5:116845042-116845064 CAAGTTTTCCACAGACAGAGGGG + Intergenic
996034223 5:118740014-118740036 CAGGGTCACCACAGCCAGATGGG + Intergenic
996627057 5:125583085-125583107 GAAGGTAACCACAGACAGGGAGG + Intergenic
997614550 5:135237440-135237462 GAAGATCCCCACAGCCAGGGAGG + Intronic
999225732 5:150022567-150022589 AAAAATCACCACAGAAAGATTGG - Intronic
1001658278 5:173370903-173370925 CAAGATGACCACAAGCAGAGAGG - Intergenic
1004023227 6:11793687-11793709 CAAGATAATCACTGACACAGAGG - Intronic
1006169501 6:32085071-32085093 CAAGCTCACCACTGGAAGAGAGG - Intronic
1010891432 6:81316410-81316432 AAAGAACACCACAGACTGGGTGG - Intergenic
1011247347 6:85333377-85333399 GAAGATCAGCATAGACAGAGTGG + Intergenic
1012492390 6:99796771-99796793 CAAGAGCACCATAGACTGAGTGG + Intergenic
1013163928 6:107572684-107572706 TAACCTCACCAAAGACAGAGAGG - Intronic
1013426949 6:110020933-110020955 CAAGATGACCACAGAAAAACAGG - Intergenic
1014201279 6:118611738-118611760 TAAAATTACCAAAGACAGAGAGG + Intronic
1015135169 6:129861055-129861077 CAAGTTGCCCACTGACAGAGAGG + Intronic
1015509043 6:134019479-134019501 CAAGAGCACCCCAGAAACAGTGG + Intronic
1019389452 7:777809-777831 CAAGATCACGAGACAGAGAGGGG + Intronic
1019617675 7:1973591-1973613 CACGAGGACCACAGACAGGGGGG + Intronic
1022206884 7:28173338-28173360 CAAGATCACCATGGATAGTGAGG - Intronic
1022804542 7:33808543-33808565 CTAGATCCCCATAGGCAGAGTGG - Intergenic
1022932476 7:35133347-35133369 CAAAAGTACCACAGACAGGGTGG - Intergenic
1024117050 7:46204458-46204480 CAAGATCACAACATGGAGAGAGG - Intergenic
1024499231 7:50085341-50085363 CAAAAGAACCACAGACAGGGTGG - Intronic
1027779814 7:82507467-82507489 CAAGATGACCAGCAACAGAGAGG - Intergenic
1029303535 7:99602281-99602303 CAGGCTCAGCACAGACAGAGGGG + Intronic
1029482094 7:100819557-100819579 CAATGTCACCACTGACCGAGAGG - Exonic
1029980366 7:104872986-104873008 CAGCATCTCCACAGACAGGGAGG + Intronic
1031121789 7:117730266-117730288 CAATGTGACCACAGATAGAGAGG + Intronic
1032057220 7:128693430-128693452 CACGATGACTACAGACAGAGTGG - Intergenic
1033392998 7:140946234-140946256 AAAAATCACCAGAGACAGATGGG - Intergenic
1034401440 7:150864161-150864183 CAAGATGTCCACAGTCACAGGGG + Intergenic
1034884504 7:154788752-154788774 CACGATAACCAAAGACAAAGAGG - Intronic
1035769329 8:2134311-2134333 CCAGATAAACCCAGACAGAGGGG - Intronic
1037214589 8:16433442-16433464 GAAAAACACCACAGACATAGTGG + Intronic
1037987228 8:23297695-23297717 CGAGCTCACCACAGACACAGTGG - Exonic
1039343269 8:36674488-36674510 CAAGATCACAGCAGTCACAGAGG + Intergenic
1043482237 8:80665003-80665025 CAAGCTCAACACAGACTCAGTGG - Exonic
1045079840 8:98613931-98613953 GAAAATTACCAGAGACAGAGAGG + Intronic
1047529075 8:125658943-125658965 CAACATCATCAGAGAGAGAGAGG - Intergenic
1050328171 9:4517810-4517832 CAAGACCACCACAGACCCATGGG + Intronic
1050552673 9:6761416-6761438 CCAGAGCACAGCAGACAGAGAGG - Intronic
1050971077 9:11875225-11875247 CAAGATCAGAACATACAGAAAGG + Intergenic
1051281449 9:15445746-15445768 CAAGATCAGCCTAGACAAAGTGG + Intronic
1052341774 9:27370703-27370725 CAAAAATACCACAAACAGAGTGG - Intronic
1055527896 9:77153799-77153821 CTAGATAACCACAGAAACAGAGG + Intergenic
1056322108 9:85445052-85445074 CAACATCACCACAGAGGGAAGGG - Intergenic
1056426479 9:86482480-86482502 CAAGGTCACCACAGACCGACTGG - Intergenic
1058161661 9:101576734-101576756 CAGGAATACCACAGACTGAGAGG + Intronic
1058414840 9:104776633-104776655 CAAGAGTACCATAGACAGGGTGG - Intronic
1059088196 9:111327687-111327709 CAAAATCACCACAGTCAAATGGG + Exonic
1059733155 9:117076285-117076307 GAAGATTATCCCAGACAGAGGGG + Intronic
1062228446 9:135467188-135467210 CAAGTTCCCCACAGTGAGAGTGG + Intergenic
1062599815 9:137314703-137314725 CAATGTCTCCACAGACAGTGTGG + Intronic
1187773108 X:22724176-22724198 CAACATCACCACAAACAGGTGGG - Intergenic
1188521106 X:31039015-31039037 GACGATGACCACAGGCAGAGAGG - Intergenic
1189074696 X:37903966-37903988 CAAGAATGCCACAGACTGAGGGG - Intronic
1189239000 X:39511373-39511395 CAAGATCATCACAAAGTGAGGGG + Intergenic
1189890262 X:45593595-45593617 GAAAATTACCAGAGACAGAGAGG - Intergenic
1193409559 X:81145884-81145906 AAAGATCAAAACAGACAAAGAGG + Intronic
1193516794 X:82475833-82475855 AAAGATCAAAAGAGACAGAGAGG - Intergenic
1195277055 X:103292064-103292086 CAAGAGTCCCACAGACAGTGTGG - Intergenic
1197378435 X:125710048-125710070 CAAGATGACCAGCTACAGAGAGG + Intergenic
1199532644 X:148867766-148867788 CCAGAGTACCACAGGCAGAGAGG - Intronic
1200887144 Y:8281238-8281260 CAAGACCACCACAGACACGAAGG + Intergenic