ID: 968551071

View in Genome Browser
Species Human (GRCh38)
Location 4:1223591-1223613
Sequence CTCCTGAGGAACCCGCGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 29}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968551059_968551071 13 Left 968551059 4:1223555-1223577 CCCTGGCATGGCAAGGCCCTTGC 0: 1
1: 0
2: 0
3: 15
4: 189
Right 968551071 4:1223591-1223613 CTCCTGAGGAACCCGCGATCTGG 0: 1
1: 0
2: 0
3: 5
4: 29
968551064_968551071 -3 Left 968551064 4:1223571-1223593 CCCTTGCATCCCCATGGGGCCTC 0: 1
1: 0
2: 0
3: 19
4: 174
Right 968551071 4:1223591-1223613 CTCCTGAGGAACCCGCGATCTGG 0: 1
1: 0
2: 0
3: 5
4: 29
968551056_968551071 28 Left 968551056 4:1223540-1223562 CCGGTCAAGGGGAGTCCCTGGCA 0: 1
1: 0
2: 0
3: 9
4: 133
Right 968551071 4:1223591-1223613 CTCCTGAGGAACCCGCGATCTGG 0: 1
1: 0
2: 0
3: 5
4: 29
968551065_968551071 -4 Left 968551065 4:1223572-1223594 CCTTGCATCCCCATGGGGCCTCC 0: 1
1: 0
2: 1
3: 21
4: 230
Right 968551071 4:1223591-1223613 CTCCTGAGGAACCCGCGATCTGG 0: 1
1: 0
2: 0
3: 5
4: 29
968551060_968551071 12 Left 968551060 4:1223556-1223578 CCTGGCATGGCAAGGCCCTTGCA 0: 1
1: 0
2: 2
3: 12
4: 173
Right 968551071 4:1223591-1223613 CTCCTGAGGAACCCGCGATCTGG 0: 1
1: 0
2: 0
3: 5
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968551071 Original CRISPR CTCCTGAGGAACCCGCGATC TGG Intronic
903738304 1:25544020-25544042 CACCTGAGGACCCCGAGCTCGGG - Intronic
1080773752 11:35366480-35366502 CTCCTGAGGAACAAGGGAGCTGG - Intronic
1082793447 11:57363494-57363516 CTCCTGAGCAACTGGCCATCAGG + Intronic
1095630179 12:44367275-44367297 CTCCTGAGGAAGCCGACATTGGG - Intronic
1122116554 14:99530479-99530501 CTCCGGAGGAACCCGGGCTCAGG + Intronic
1126583739 15:50263277-50263299 CTCCTGAGGACCCCGACAGCTGG - Exonic
1128081142 15:64857615-64857637 CTCCTAAGGAACCCTGTATCTGG - Intronic
1142738568 17:1917288-1917310 CTCCTGGGGCACCTGCGAACGGG + Intergenic
1144797438 17:17901773-17901795 CTCATGAGGAACCCCTGACCTGG - Intronic
1147904988 17:43816781-43816803 TGCCTGAGGAGCCCGCCATCTGG + Intronic
1160861114 19:1237581-1237603 CTCCAGAGGGACCCCCGCTCAGG - Intronic
1162647269 19:12058960-12058982 CCACTGAGGAACCCACGGTCTGG - Intergenic
932287580 2:70549853-70549875 ATCCTGAGGAACCCAAAATCTGG + Intronic
946354476 2:219176523-219176545 CTCCCGGGGAACCCTCGATGGGG - Intronic
1176236916 20:64057721-64057743 CTCCTGAGGGACCCGGGACCAGG + Intronic
1184227357 22:43136764-43136786 CTTCTGAGGAGCCTGTGATCTGG - Intronic
1185169222 22:49282730-49282752 CTCCTGGGGAACCCGGGTCCAGG - Intergenic
1185322066 22:50206033-50206055 CTGCTGCGGAACCCTCGTTCTGG + Intronic
959933767 3:112009463-112009485 CTCAGTAGGAACCAGCGATCAGG - Intronic
968551071 4:1223591-1223613 CTCCTGAGGAACCCGCGATCTGG + Intronic
986453376 5:7889770-7889792 CTCTTGAAGGACCCTCGATCTGG - Intronic
994725847 5:103434361-103434383 CTCTTGGGGAACCCGGGAACAGG + Intergenic
998594619 5:143515933-143515955 CTCCTTAGGAACCAGGCATCAGG + Intergenic
999395447 5:151224014-151224036 CCCCAGAGGAGCCTGCGATCCGG + Exonic
999926056 5:156379413-156379435 TTCCTGAGGAACACGCCATATGG + Intronic
1015419964 6:132996297-132996319 CTGCTGAGGACCCCGCTATCAGG - Intergenic
1022485115 7:30771798-30771820 CTCCTGGGGCATCCGCGCTCCGG + Intronic
1029092367 7:98058182-98058204 CTCCTGTGGGACACGTGATCTGG - Intergenic
1030235836 7:107261073-107261095 GCCCTGAGGAACCCGCGTACAGG + Intronic
1034253678 7:149713374-149713396 CTCCTAAGGAGCCCGCAACCTGG - Intergenic
1036691181 8:10945815-10945837 CTGCTGGGGAACCCGAGAGCTGG + Intronic
1045416887 8:101976343-101976365 CTCCTGAGGGACCTGGGATTGGG + Intronic
1186614996 X:11177148-11177170 CTCCTGAGGAATCCGAGGTCAGG + Intronic
1191797474 X:65035640-65035662 CTCCTGAGAAGCCCGCGGTCAGG - Intergenic
1201587498 Y:15577154-15577176 CTCCTGTGGAAGCTGAGATCTGG + Intergenic