ID: 968551598

View in Genome Browser
Species Human (GRCh38)
Location 4:1226292-1226314
Sequence TGCAATCATCCGGATGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 84}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968551598_968551604 -6 Left 968551598 4:1226292-1226314 CCCACCCCATCCGGATGATTGCA 0: 1
1: 0
2: 0
3: 5
4: 84
Right 968551604 4:1226309-1226331 ATTGCATTCCTGTGTCCGACTGG 0: 1
1: 0
2: 0
3: 0
4: 50
968551598_968551607 10 Left 968551598 4:1226292-1226314 CCCACCCCATCCGGATGATTGCA 0: 1
1: 0
2: 0
3: 5
4: 84
Right 968551607 4:1226325-1226347 CGACTGGCCATCCGTCTCCCTGG 0: 1
1: 0
2: 0
3: 2
4: 55
968551598_968551612 18 Left 968551598 4:1226292-1226314 CCCACCCCATCCGGATGATTGCA 0: 1
1: 0
2: 0
3: 5
4: 84
Right 968551612 4:1226333-1226355 CATCCGTCTCCCTGGGGAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 234
968551598_968551609 12 Left 968551598 4:1226292-1226314 CCCACCCCATCCGGATGATTGCA 0: 1
1: 0
2: 0
3: 5
4: 84
Right 968551609 4:1226327-1226349 ACTGGCCATCCGTCTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 138
968551598_968551610 15 Left 968551598 4:1226292-1226314 CCCACCCCATCCGGATGATTGCA 0: 1
1: 0
2: 0
3: 5
4: 84
Right 968551610 4:1226330-1226352 GGCCATCCGTCTCCCTGGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 127
968551598_968551608 11 Left 968551598 4:1226292-1226314 CCCACCCCATCCGGATGATTGCA 0: 1
1: 0
2: 0
3: 5
4: 84
Right 968551608 4:1226326-1226348 GACTGGCCATCCGTCTCCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 91
968551598_968551617 24 Left 968551598 4:1226292-1226314 CCCACCCCATCCGGATGATTGCA 0: 1
1: 0
2: 0
3: 5
4: 84
Right 968551617 4:1226339-1226361 TCTCCCTGGGGAGGAGGAGGGGG No data
968551598_968551615 22 Left 968551598 4:1226292-1226314 CCCACCCCATCCGGATGATTGCA 0: 1
1: 0
2: 0
3: 5
4: 84
Right 968551615 4:1226337-1226359 CGTCTCCCTGGGGAGGAGGAGGG No data
968551598_968551620 28 Left 968551598 4:1226292-1226314 CCCACCCCATCCGGATGATTGCA 0: 1
1: 0
2: 0
3: 5
4: 84
Right 968551620 4:1226343-1226365 CCTGGGGAGGAGGAGGGGGCAGG 0: 1
1: 4
2: 39
3: 368
4: 2868
968551598_968551614 21 Left 968551598 4:1226292-1226314 CCCACCCCATCCGGATGATTGCA 0: 1
1: 0
2: 0
3: 5
4: 84
Right 968551614 4:1226336-1226358 CCGTCTCCCTGGGGAGGAGGAGG No data
968551598_968551616 23 Left 968551598 4:1226292-1226314 CCCACCCCATCCGGATGATTGCA 0: 1
1: 0
2: 0
3: 5
4: 84
Right 968551616 4:1226338-1226360 GTCTCCCTGGGGAGGAGGAGGGG 0: 1
1: 0
2: 9
3: 84
4: 1273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968551598 Original CRISPR TGCAATCATCCGGATGGGGT GGG (reversed) Intronic
911344600 1:96681349-96681371 TGCCATGATCAGGCTGGGGTTGG - Intergenic
911926216 1:103835637-103835659 TGAAATCATCTGGAAGGGGGAGG + Intergenic
913560526 1:120014463-120014485 TTCAAACATACGCATGGGGTTGG + Intronic
913637600 1:120779139-120779161 TTCAAACATACGCATGGGGTTGG - Intergenic
914281113 1:146173872-146173894 TTCAAACATACGCATGGGGTTGG + Intronic
914542156 1:148624811-148624833 TTCAAACATACGCATGGGGTTGG + Intronic
914624483 1:149446432-149446454 TTCAAACATACGCATGGGGTTGG - Intergenic
920089667 1:203443242-203443264 TGCAATGAAGAGGATGGGGTAGG + Intergenic
920391888 1:205610174-205610196 TGGGATCTTCTGGATGGGGTCGG - Exonic
1063089040 10:2845323-2845345 TGCAACGATCCCGATGGGCTGGG + Intergenic
1069687872 10:70330671-70330693 GGCATGCATCCTGATGGGGTGGG + Intronic
1073047562 10:100649632-100649654 GGCCATCATCAAGATGGGGTGGG + Intergenic
1075717391 10:124564856-124564878 TGCAATGATCTGGATGAGATTGG + Intronic
1077754822 11:5015557-5015579 TGTAATCATTGGGATTGGGTTGG + Intergenic
1083668084 11:64286028-64286050 TCCAATAATGCGGATGGGGAGGG - Intronic
1084220969 11:67678871-67678893 TGCAATGATCTGGATGAGATTGG + Intronic
1084937777 11:72596205-72596227 TGGGATCCTCCAGATGGGGTGGG - Intronic
1088407205 11:109495166-109495188 TGCAGTAATCAAGATGGGGTAGG + Intergenic
1089171377 11:116513936-116513958 GGCAATGATCCGGCTGAGGTTGG + Intergenic
1090599628 11:128356990-128357012 TGGAATCTTCAGGATGGGATGGG - Intergenic
1091793669 12:3285447-3285469 TGCAAACAGACGGATGAGGTGGG - Exonic
1098787899 12:74782381-74782403 TGCAATCAGCTGCAGGGGGTTGG + Intergenic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1107456407 13:40559769-40559791 GGCACTCATCTGCATGGGGTGGG + Exonic
1110430745 13:75420173-75420195 TGCCATCTTCCAGAAGGGGTGGG + Intronic
1112810910 13:103217448-103217470 TTCAACCATCAGGATGGGGTGGG - Intergenic
1121694611 14:95902658-95902680 GGTAATCATGGGGATGGGGTGGG + Intergenic
1125829635 15:42704994-42705016 CCCATTCATCCTGATGGGGTGGG + Intronic
1126964212 15:54032830-54032852 TGCAGGAATCCGGATGGGATTGG + Intronic
1129466108 15:75725233-75725255 CCCAGTCATCCGGCTGGGGTTGG + Intronic
1131265104 15:90911052-90911074 AGAACTCATCCGGATGGGGAAGG - Intronic
1133072516 16:3255947-3255969 TGCAATCATATGAACGGGGTTGG - Intronic
1134472868 16:14542980-14543002 TGCAATTGTCCTGTTGGGGTTGG - Intronic
1134612575 16:15621622-15621644 TGCAATCATCACAAGGGGGTGGG + Intronic
1137809152 16:51336223-51336245 TCCAAGCCTCCGGCTGGGGTGGG - Intergenic
1139589797 16:67927258-67927280 TGGCCTCATCCAGATGGGGTGGG + Intronic
1140983573 16:80136142-80136164 TGCAATCAACCCTATTGGGTCGG + Intergenic
1141790819 16:86232846-86232868 TTCTATCATCTGGTTGGGGTTGG - Intergenic
1142841115 17:2631393-2631415 TGTAACCATCTGAATGGGGTGGG - Intronic
1152667202 17:81577980-81578002 TGCTGACAGCCGGATGGGGTGGG - Intronic
1156098653 18:33566381-33566403 TGCAGTCATTGGGGTGGGGTGGG + Intergenic
1158890907 18:61870969-61870991 TGCCATTATCAGGATGGGGTCGG - Intronic
1161567705 19:5012748-5012770 GGCCATCAGCAGGATGGGGTTGG + Intronic
1163125135 19:15240452-15240474 TGCAATCATCCAGGTGGGCCAGG - Intronic
928283511 2:29969180-29969202 TGCAAACATCTGGAAGGGGGTGG + Intergenic
932888119 2:75565508-75565530 TGAAATCATCCTCATGTGGTAGG + Intronic
935789283 2:106576140-106576162 TGTAATCAGCCTGATGGTGTGGG + Intergenic
945889638 2:215414882-215414904 TGCATTCCACTGGATGGGGTGGG + Exonic
948192091 2:236067244-236067266 TGAAATCATCCTGATGAGGCAGG - Intronic
1178220130 21:30646872-30646894 TCCAGTCATCTGGATGGGATGGG + Intergenic
1178997705 21:37420336-37420358 TCATATCATCCTGATGGGGTGGG - Exonic
960986896 3:123286676-123286698 TGCACTCACCTGGATGCGGTCGG + Exonic
963034908 3:141017568-141017590 AGCAATCAGCAGGATGTGGTCGG + Intergenic
967933534 3:194708134-194708156 TGCAGTCATCTGCATGGGGCTGG + Intergenic
967941422 3:194769278-194769300 ATCAATCATCCAGAAGGGGTGGG - Intergenic
968551598 4:1226292-1226314 TGCAATCATCCGGATGGGGTGGG - Intronic
981163073 4:141522145-141522167 AGCCATTATCAGGATGGGGTGGG + Intergenic
983422557 4:167538563-167538585 TGCAATGATCTGGATGAGATTGG + Intergenic
985480585 5:107844-107866 TGCAGTGATCCGGGTGGGGCTGG + Intergenic
990282179 5:54262981-54263003 TGAATTCATTTGGATGGGGTGGG + Intronic
996416013 5:123211160-123211182 TTCAATCCTCAGGAAGGGGTAGG - Intergenic
997876518 5:137553020-137553042 TGCAACAATCTGGATGGAGTTGG - Intronic
998704646 5:144744619-144744641 TGCCCACATTCGGATGGGGTTGG + Intergenic
1000485284 5:161834123-161834145 TGTAATCACTAGGATGGGGTGGG - Intergenic
1002422114 5:179154246-179154268 TCCTATCATCGGGGTGGGGTGGG - Intronic
1002697287 5:181099392-181099414 GGCACTCATCTGCATGGGGTGGG + Intergenic
1005098953 6:22148268-22148290 TGCATTCCTGCGGATGGGGCTGG + Intergenic
1008594963 6:53032941-53032963 TTCCATCATCTGGAGGGGGTGGG - Intronic
1013071844 6:106736600-106736622 TGAAATCTTCTGGATGGGCTGGG - Intergenic
1015568431 6:134597318-134597340 TGCAATGATCTGGATGAGATTGG - Intergenic
1017282335 6:152637878-152637900 TGCAATCATCCTGTTGGACTTGG - Intergenic
1020287869 7:6699478-6699500 TGGATTCATCTGGCTGGGGTGGG - Intronic
1023873273 7:44274040-44274062 TGCTCTCATCCGGAGGTGGTAGG - Intronic
1024179354 7:46874424-46874446 TGCAATCATCTGGATGAGATCGG + Intergenic
1025022073 7:55488096-55488118 TGCCAGCATCCTGATGGGGAAGG + Intronic
1026235582 7:68524093-68524115 TGCAATCATCCGAAAGGGTGAGG - Intergenic
1028298665 7:89169134-89169156 TTCACTCCTCCGGATGGGGCAGG - Intronic
1028852409 7:95552218-95552240 ACCAATCAGCAGGATGGGGTGGG - Intergenic
1030651901 7:112125242-112125264 TGGGATCATCCTGATGGGGCAGG - Intronic
1035586933 8:783749-783771 TGCAAGATTCCGGATGTGGTGGG - Intergenic
1043871476 8:85438496-85438518 TGCATTCTTGGGGATGGGGTGGG - Intronic
1047953566 8:129955913-129955935 TGCATCCATCGGGATGGGATAGG + Intronic
1062100381 9:134724933-134724955 TGCCATCCTCCAGATGGGGTTGG + Intronic
1188861925 X:35268687-35268709 TGCAATGATCTGGATGAGATTGG + Intergenic
1189973964 X:46444412-46444434 TTCAGTCATCCTGGTGGGGTGGG - Intergenic
1192584599 X:72309136-72309158 TTCAATGGTCCGGATGGGGGAGG - Intergenic
1193638226 X:83979489-83979511 TGCAGCAATCCGGATGGAGTTGG + Intergenic
1199596576 X:149510742-149510764 TGCATTCATCTGAATGGAGTGGG + Intronic
1199811246 X:151351910-151351932 TGCAATCATATGGATGGAATGGG - Intergenic
1201986466 Y:19974041-19974063 TGCAAGCATCAGGACAGGGTAGG - Intergenic