ID: 968551599

View in Genome Browser
Species Human (GRCh38)
Location 4:1226293-1226315
Sequence ATGCAATCATCCGGATGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 59}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968551599_968551614 20 Left 968551599 4:1226293-1226315 CCACCCCATCCGGATGATTGCAT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 968551614 4:1226336-1226358 CCGTCTCCCTGGGGAGGAGGAGG No data
968551599_968551617 23 Left 968551599 4:1226293-1226315 CCACCCCATCCGGATGATTGCAT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 968551617 4:1226339-1226361 TCTCCCTGGGGAGGAGGAGGGGG No data
968551599_968551609 11 Left 968551599 4:1226293-1226315 CCACCCCATCCGGATGATTGCAT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 968551609 4:1226327-1226349 ACTGGCCATCCGTCTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 138
968551599_968551616 22 Left 968551599 4:1226293-1226315 CCACCCCATCCGGATGATTGCAT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 968551616 4:1226338-1226360 GTCTCCCTGGGGAGGAGGAGGGG 0: 1
1: 0
2: 9
3: 84
4: 1273
968551599_968551610 14 Left 968551599 4:1226293-1226315 CCACCCCATCCGGATGATTGCAT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 968551610 4:1226330-1226352 GGCCATCCGTCTCCCTGGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 127
968551599_968551620 27 Left 968551599 4:1226293-1226315 CCACCCCATCCGGATGATTGCAT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 968551620 4:1226343-1226365 CCTGGGGAGGAGGAGGGGGCAGG 0: 1
1: 4
2: 39
3: 368
4: 2868
968551599_968551621 30 Left 968551599 4:1226293-1226315 CCACCCCATCCGGATGATTGCAT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 968551621 4:1226346-1226368 GGGGAGGAGGAGGGGGCAGGAGG 0: 1
1: 17
2: 169
3: 1320
4: 6809
968551599_968551604 -7 Left 968551599 4:1226293-1226315 CCACCCCATCCGGATGATTGCAT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 968551604 4:1226309-1226331 ATTGCATTCCTGTGTCCGACTGG 0: 1
1: 0
2: 0
3: 0
4: 50
968551599_968551615 21 Left 968551599 4:1226293-1226315 CCACCCCATCCGGATGATTGCAT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 968551615 4:1226337-1226359 CGTCTCCCTGGGGAGGAGGAGGG No data
968551599_968551607 9 Left 968551599 4:1226293-1226315 CCACCCCATCCGGATGATTGCAT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 968551607 4:1226325-1226347 CGACTGGCCATCCGTCTCCCTGG 0: 1
1: 0
2: 0
3: 2
4: 55
968551599_968551612 17 Left 968551599 4:1226293-1226315 CCACCCCATCCGGATGATTGCAT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 968551612 4:1226333-1226355 CATCCGTCTCCCTGGGGAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 234
968551599_968551608 10 Left 968551599 4:1226293-1226315 CCACCCCATCCGGATGATTGCAT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 968551608 4:1226326-1226348 GACTGGCCATCCGTCTCCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968551599 Original CRISPR ATGCAATCATCCGGATGGGG TGG (reversed) Intronic
903816271 1:26066619-26066641 AAGCAATCGTCAGGATGGGGAGG + Intronic
910837495 1:91530442-91530464 ATACAATGAGCAGGATGGGGTGG - Intergenic
919086299 1:192924688-192924710 ATGAAATCAGCCGGGTGTGGTGG + Intergenic
920820253 1:209373831-209373853 CTGAACTCATCTGGATGGGGGGG - Intergenic
1076102439 10:127793957-127793979 CTGAAAGCATCAGGATGGGGAGG + Intergenic
1081121622 11:39273507-39273529 AAGCAATCAACCGGGTGCGGTGG - Intergenic
1083654152 11:64220926-64220948 ATGCTGTCACCCTGATGGGGAGG + Intronic
1083668085 11:64286029-64286051 CTCCAATAATGCGGATGGGGAGG - Intronic
1088010639 11:104996687-104996709 ATGCAAACTTCAGGATGGCGGGG - Intronic
1093137318 12:15467965-15467987 ATGGAAACATCCAGATGGTGAGG - Intronic
1097711726 12:62924752-62924774 ATGCAATTAGCCGGGTGTGGTGG + Intronic
1097946337 12:65372849-65372871 TTTCTATCATCTGGATGGGGAGG + Intronic
1104994929 12:132648321-132648343 ATGAAAATATCCGAATGGGGGGG + Intronic
1112810911 13:103217449-103217471 ATTCAACCATCAGGATGGGGTGG - Intergenic
1117329452 14:54697910-54697932 ATGCAAGCAACCCAATGGGGAGG - Intronic
1127230229 15:56983847-56983869 ATGAAATCAGCCGGGTAGGGTGG + Intronic
1128255618 15:66194453-66194475 ATGAAATTATCCGGGTGTGGTGG + Intronic
1130893677 15:88153873-88153895 ATACCATCATCTGGAAGGGGAGG + Intronic
1132667358 16:1088290-1088312 AGGCAAGCATCGGGCTGGGGAGG - Intergenic
1133271627 16:4613431-4613453 ATGTACTCATCTGGATGGGATGG + Intronic
1134612574 16:15621621-15621643 ATGCAATCATCACAAGGGGGTGG + Intronic
1159564029 18:70027227-70027249 ATGCAAACAGCAGGGTGGGGTGG + Intronic
1160928307 19:1557411-1557433 AAGCAATCATCCGGGTGTAGCGG + Intronic
1163091497 19:15023135-15023157 ATCCAATCAGCTGGCTGGGGCGG - Exonic
1167382425 19:49146288-49146310 ATGCCATCATCCCCATGGGGGGG + Intronic
1168112209 19:54199639-54199661 ATCCAGGCATCCGGATGGTGTGG + Intergenic
928660055 2:33492842-33492864 ATGGAGGCATCAGGATGGGGAGG + Intronic
931212737 2:60213370-60213392 ATGCAATCAGGGGGATTGGGGGG - Intergenic
935789282 2:106576139-106576161 ATGTAATCAGCCTGATGGTGTGG + Intergenic
940294370 2:152107284-152107306 ATTAAATCGTCCGGATGTGGTGG + Intergenic
948346952 2:237306616-237306638 ATGCAGTAATCCTAATGGGGAGG - Intergenic
1174320241 20:49736024-49736046 ATTCAATCTGCCGGATGCGGTGG - Intergenic
1178220129 21:30646871-30646893 ATCCAGTCATCTGGATGGGATGG + Intergenic
954220489 3:49150575-49150597 ATGCTATCATCCAGGTGTGGTGG + Intergenic
956739286 3:72262536-72262558 ATTCAATCCTCTGGAGGGGGAGG + Intergenic
959674480 3:109019252-109019274 ATGCAAGCAGCAGGATGTGGTGG - Intronic
960153727 3:114276877-114276899 ATAGAATAATCCGGAGGGGGAGG + Intergenic
962469673 3:135695025-135695047 ATGGAATCATAGGGGTGGGGAGG - Intergenic
967941423 3:194769279-194769301 AATCAATCATCCAGAAGGGGTGG - Intergenic
968551599 4:1226293-1226315 ATGCAATCATCCGGATGGGGTGG - Intronic
970390090 4:15600399-15600421 ATGCCATCATACGGAAGAGGAGG - Intronic
981654192 4:147093268-147093290 ATGGAATCATCTGGGTGGTGAGG + Intergenic
989610999 5:43291412-43291434 ATACAATTATCCATATGGGGGGG + Intronic
990361369 5:55023949-55023971 AAGCAATTAGCCGGATGTGGTGG + Intergenic
996249562 5:121312326-121312348 ATGCATTCGTTCTGATGGGGAGG - Intergenic
1005058426 6:21753108-21753130 ATGCAATTATCCAGATGGTTGGG + Intergenic
1007731785 6:43951791-43951813 ATGAGATCATGCGGATGGCGTGG + Intergenic
1008051812 6:46907962-46907984 ATGCAACCATCCAGAAGGGCAGG + Intronic
1008594964 6:53032942-53032964 ATTCCATCATCTGGAGGGGGTGG - Intronic
1013071845 6:106736601-106736623 ATGAAATCTTCTGGATGGGCTGG - Intergenic
1013173439 6:107657873-107657895 ATGCAGTCATGTGGAGGGGGAGG + Intronic
1019763866 7:2835045-2835067 ATGCAATCATGTGGATGGTTAGG + Intronic
1024866906 7:53913598-53913620 ATGAAATCATCTGGATGTGGAGG + Intergenic
1026931322 7:74224414-74224436 ATGCATGCAGCTGGATGGGGCGG - Intronic
1029467628 7:100736354-100736376 ATGAAATCAGCCGGGTGTGGTGG - Intronic
1035207845 7:157306096-157306118 ATAAAATCAGCCGGATGTGGTGG + Intergenic
1040689977 8:49924998-49925020 AAGTAATTATCCGGATGTGGTGG + Intronic
1043871477 8:85438497-85438519 ATGCATTCTTGGGGATGGGGTGG - Intronic
1050460505 9:5873689-5873711 ATGCAATCGGCCGGGTGTGGTGG + Intergenic
1053362017 9:37495012-37495034 AAGCAGTCAGCCTGATGGGGAGG + Intronic
1055715391 9:79111891-79111913 ATGCAATCACTCTGATGGAGCGG - Intergenic
1058727657 9:107818603-107818625 GCCCAATCATCAGGATGGGGGGG + Intergenic
1187944344 X:24411890-24411912 ATGCAATGATCTGGATGGTCAGG - Intergenic
1189665351 X:43349647-43349669 AAGCACTCACCCTGATGGGGAGG + Intergenic