ID: 968551601

View in Genome Browser
Species Human (GRCh38)
Location 4:1226297-1226319
Sequence AGGAATGCAATCATCCGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 284}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968551601_968551620 23 Left 968551601 4:1226297-1226319 CCCATCCGGATGATTGCATTCCT 0: 1
1: 0
2: 0
3: 5
4: 284
Right 968551620 4:1226343-1226365 CCTGGGGAGGAGGAGGGGGCAGG 0: 1
1: 4
2: 39
3: 368
4: 2868
968551601_968551608 6 Left 968551601 4:1226297-1226319 CCCATCCGGATGATTGCATTCCT 0: 1
1: 0
2: 0
3: 5
4: 284
Right 968551608 4:1226326-1226348 GACTGGCCATCCGTCTCCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 91
968551601_968551609 7 Left 968551601 4:1226297-1226319 CCCATCCGGATGATTGCATTCCT 0: 1
1: 0
2: 0
3: 5
4: 284
Right 968551609 4:1226327-1226349 ACTGGCCATCCGTCTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 138
968551601_968551617 19 Left 968551601 4:1226297-1226319 CCCATCCGGATGATTGCATTCCT 0: 1
1: 0
2: 0
3: 5
4: 284
Right 968551617 4:1226339-1226361 TCTCCCTGGGGAGGAGGAGGGGG No data
968551601_968551610 10 Left 968551601 4:1226297-1226319 CCCATCCGGATGATTGCATTCCT 0: 1
1: 0
2: 0
3: 5
4: 284
Right 968551610 4:1226330-1226352 GGCCATCCGTCTCCCTGGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 127
968551601_968551616 18 Left 968551601 4:1226297-1226319 CCCATCCGGATGATTGCATTCCT 0: 1
1: 0
2: 0
3: 5
4: 284
Right 968551616 4:1226338-1226360 GTCTCCCTGGGGAGGAGGAGGGG 0: 1
1: 0
2: 9
3: 84
4: 1273
968551601_968551612 13 Left 968551601 4:1226297-1226319 CCCATCCGGATGATTGCATTCCT 0: 1
1: 0
2: 0
3: 5
4: 284
Right 968551612 4:1226333-1226355 CATCCGTCTCCCTGGGGAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 234
968551601_968551621 26 Left 968551601 4:1226297-1226319 CCCATCCGGATGATTGCATTCCT 0: 1
1: 0
2: 0
3: 5
4: 284
Right 968551621 4:1226346-1226368 GGGGAGGAGGAGGGGGCAGGAGG 0: 1
1: 17
2: 169
3: 1320
4: 6809
968551601_968551615 17 Left 968551601 4:1226297-1226319 CCCATCCGGATGATTGCATTCCT 0: 1
1: 0
2: 0
3: 5
4: 284
Right 968551615 4:1226337-1226359 CGTCTCCCTGGGGAGGAGGAGGG No data
968551601_968551614 16 Left 968551601 4:1226297-1226319 CCCATCCGGATGATTGCATTCCT 0: 1
1: 0
2: 0
3: 5
4: 284
Right 968551614 4:1226336-1226358 CCGTCTCCCTGGGGAGGAGGAGG No data
968551601_968551607 5 Left 968551601 4:1226297-1226319 CCCATCCGGATGATTGCATTCCT 0: 1
1: 0
2: 0
3: 5
4: 284
Right 968551607 4:1226325-1226347 CGACTGGCCATCCGTCTCCCTGG 0: 1
1: 0
2: 0
3: 2
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968551601 Original CRISPR AGGAATGCAATCATCCGGAT GGG (reversed) Intronic
902996921 1:20232870-20232892 AGGAATGCATTCCTGGGGATAGG - Intergenic
903174179 1:21570783-21570805 AGGAGGGCAATCGTCAGGATGGG - Intronic
904112323 1:28135849-28135871 AGGAATGTAATCTTTCGGCTAGG + Intergenic
916582611 1:166122163-166122185 AGGAATGAAATCATCCCTAGGGG + Intronic
919155421 1:193758970-193758992 AGGAATGAAGTCATCTGGACTGG - Intergenic
920503257 1:206498844-206498866 AGGAATGCAAACATCCAGTGTGG + Intergenic
920733332 1:208509268-208509290 AGGTATGCAGTCAACCTGATTGG + Intergenic
923250273 1:232174087-232174109 AGTAATGCTATCATCTGGGTAGG + Intergenic
1066763925 10:38785511-38785533 TGGAATGGAATCAAACGGATTGG - Intergenic
1066765302 10:38797221-38797243 AGGAATGAAATCATACGTAACGG - Intergenic
1066772203 10:38855486-38855508 AGGAATGTAATCAAACGGAATGG + Intergenic
1066937509 10:41857391-41857413 AGGAATGGAATCAACCCGAGTGG + Intergenic
1066937569 10:41857780-41857802 AGGAATGGAATCAACCCGAGTGG + Intergenic
1066938082 10:41861124-41861146 TGGAATGAAATCAACCAGATTGG + Intergenic
1066938163 10:41861648-41861670 TGGAATGGAATCATCCCGACTGG + Intergenic
1066938231 10:41862082-41862104 AGGAATGGAATCAACTGGAATGG + Intergenic
1066938662 10:41864910-41864932 TGGAATGAAATCAACCCGATTGG + Intergenic
1066938722 10:41865294-41865316 TGGAATGAAATCAACCCGATTGG + Intergenic
1066938803 10:41865793-41865815 TGGAATGAAATCAACCCGATTGG + Intergenic
1066938905 10:41866462-41866484 AGGAATGAAATCAACCCGAGTGG + Intergenic
1066938932 10:41866637-41866659 TGGAATGAAATCAACCGGATTGG + Intergenic
1066938995 10:41867022-41867044 TGGAATGAAATCAACCCGATTGG + Intergenic
1066939049 10:41867381-41867403 TGGAATGAAATCAACCCGATTGG + Intergenic
1066939661 10:41871277-41871299 TGGAATGAAATCAACCCGATTGG + Intergenic
1066939707 10:41871577-41871599 TGGAATGAAATCAACCGGATTGG + Intergenic
1066939770 10:41871962-41871984 TGGAATGAAATCAACCCGATTGG + Intergenic
1066939823 10:41872311-41872333 TGGAATGAAATCAACCCGATTGG + Intergenic
1066940259 10:41875144-41875166 TGGAATGCAATCATCCCGAGTGG + Intergenic
1066940497 10:41876638-41876660 TGGAATGAAATCAACCCGATTGG + Intergenic
1066940644 10:41877606-41877628 TGGAATACAATCATCCCGAGTGG + Intergenic
1066940904 10:41879261-41879283 TGGAATGAAATCAACCAGATTGG + Intergenic
1066940928 10:41879401-41879423 TGGAATGAAATCAACCAGATTGG + Intergenic
1066940951 10:41879536-41879558 TGGAATGAAATCAACCAGATTGG + Intergenic
1066941150 10:41880777-41880799 TGGAATGAAATCAACCAGATTGG + Intergenic
1066941157 10:41880822-41880844 TGGAATGCAATCAACTGGAAAGG + Intergenic
1066941386 10:41882211-41882233 TGGAATGGAATCATCCCGAATGG + Intergenic
1066942062 10:41886420-41886442 TGGAATGAAATCAACCCGATTGG + Intergenic
1066942631 10:41890128-41890150 TGGAATGAAATCAACCCGATTGG + Intergenic
1066942927 10:41891947-41891969 TGGAATGAAATCAACCAGATTGG + Intergenic
1066943024 10:41892601-41892623 TGGAATGGAATCATCCCGAGTGG + Intergenic
1066943031 10:41892641-41892663 TGGAATGCAATCAACCCGAGTGG + Intergenic
1066943100 10:41893076-41893098 TGGAATGAAATCAACCCGATTGG + Intergenic
1066943144 10:41893366-41893388 TGTAATGAAATCAACCGGATTGG + Intergenic
1066943206 10:41893751-41893773 TGGAATGAAATCAACCAGATTGG + Intergenic
1066943493 10:41895593-41895615 TGGAATGAAATCAACCCGATTGG + Intergenic
1066943659 10:41896629-41896651 TGGAATGAAATCAACCCGATTGG + Intergenic
1066944610 10:41902759-41902781 TGGAATGAAATCAACCCGATTGG + Intergenic
1066944955 10:41904998-41905020 TGGAATGAAATCAACCCGATTGG + Intergenic
1066945228 10:41906702-41906724 TGGAATGAAATAAACCGGATTGG + Intergenic
1066945237 10:41906752-41906774 TGGAATGGAATCAACCGGAAAGG + Intergenic
1066945294 10:41907100-41907122 TGGAATGAAATCAACCAGATTGG + Intergenic
1066945596 10:41909047-41909069 TGGAATGAAATCAACCCGATTGG + Intergenic
1066945752 10:41910028-41910050 TGGAATGAAATCAACCCGATTGG + Intergenic
1066945779 10:41910182-41910204 TGGAATGGAATCATCCCGAGTGG + Intergenic
1066946291 10:41913417-41913439 TGGAATGGAATCATCCCGAGTGG + Intergenic
1066946643 10:41915594-41915616 TGGAATGAAATCAACCCGATTGG + Intergenic
1072479887 10:95800621-95800643 AGGAATGCATTCCTGGGGATAGG - Intronic
1073354715 10:102844667-102844689 AGGAATGCATTCCTCCGGGGAGG - Intergenic
1077963055 11:7095931-7095953 AAGAATGCAATCATACTTATTGG + Intergenic
1095280875 12:40351644-40351666 AGGAATGCAAGCATTTGGCTGGG + Exonic
1095331865 12:40975836-40975858 AGGAATTCAATCAGCTGGATAGG + Intronic
1100991499 12:100256239-100256261 AGTAATGCAATGATCAAGATTGG + Intronic
1104551920 12:129765074-129765096 AGGGATGCAATCCTCATGATTGG - Intronic
1109192663 13:59344251-59344273 GGGAATGAAACCATCTGGATGGG + Intergenic
1114634917 14:24181991-24182013 AGCAATGCCATCTTCGGGATGGG - Exonic
1118693127 14:68359330-68359352 AGGAATCCAATCACCCAGAAAGG - Intronic
1130179157 15:81607460-81607482 AGGAATGCAATCAGGCAGAAGGG - Intergenic
1132605013 16:790011-790033 AGGAATGAAGCCATCCAGATGGG - Intronic
1133271626 16:4613427-4613449 AGGGATGTACTCATCTGGATGGG + Intronic
1133388632 16:5390974-5390996 TGGAATGAAAGCATCAGGATTGG - Intergenic
1134400382 16:13904478-13904500 AGGAATAGAATCATGCTGATTGG - Intergenic
1145342826 17:21969684-21969706 TGGAATGCAATCAACCAGAGTGG + Intergenic
1145342909 17:21970178-21970200 AGGAATGGAATCAACCCGAGTGG + Intergenic
1145343185 17:21971896-21971918 TGGAATGGAATCAACCCGATTGG + Intergenic
1145343674 17:21975058-21975080 TGGAATGGAATCAACCCGATTGG + Intergenic
1145343951 17:21976802-21976824 AGGAATGGAATCAACCCGAGTGG + Intergenic
1145344520 17:21980481-21980503 CGGAATGGAATCAACCGGAGTGG + Intergenic
1145344976 17:21983636-21983658 CGGAATGGAATCAACCGGAGTGG + Intergenic
1145345975 17:21990811-21990833 AGGAATAGAATCAACCCGATTGG + Intergenic
1145698737 17:26811332-26811354 AGGAATGCAATAATATGGAATGG + Intergenic
1145701852 17:26837153-26837175 AGGAATGGCATCAGACGGATTGG + Intergenic
1147040090 17:37711758-37711780 AGGCATGGAATTATCTGGATAGG + Intronic
1149535673 17:57431669-57431691 AGGAATGCAATCTGCCAGACAGG - Intronic
1151086516 17:71387276-71387298 AGGGATGGAATCATACGGTTTGG - Intergenic
1203176090 17_KI270729v1_random:20545-20567 TGGAATGGAATCAACCGGAGTGG + Intergenic
1203176142 17_KI270729v1_random:20880-20902 TGGAATGGAATCATCCCGAGTGG + Intergenic
1203176195 17_KI270729v1_random:21195-21217 AGGAATGGAATCAACCCGAGTGG + Intergenic
1203176461 17_KI270729v1_random:22814-22836 AGGAATGGAATCAACCCGAGTGG + Intergenic
1203198393 17_KI270729v1_random:253215-253237 TGGAATGCAATCAAACGGAATGG + Intergenic
1203201129 17_KI270729v1_random:276221-276243 AGGAATGCAATCAAATGGAATGG + Intergenic
1203207998 17_KI270730v1_random:53974-53996 TGGAATGCAATCAAACGGAATGG + Intergenic
1203210723 17_KI270730v1_random:76922-76944 AGGAATGCAATCAAATGGAATGG + Intergenic
1164253604 19:23507607-23507629 AGGAATGCAGTTATACGGTTGGG - Intergenic
1166423756 19:42657713-42657735 AGGTATGAAATCATGAGGATGGG + Intronic
1168338114 19:55607972-55607994 AGGAAGCCGATCATCTGGATGGG + Intronic
928283508 2:29969175-29969197 CGGAATGCAAACATCTGGAAGGG + Intergenic
928610660 2:32988822-32988844 AGGAATGTAATTATCCATATAGG + Intronic
932521839 2:72422202-72422224 AGGAATGCAAGCACCCGGCGCGG + Intronic
934194301 2:89826879-89826901 AGGAATGGAATCAACCCGAGTGG - Intergenic
934194649 2:89829223-89829245 TGGAATGGAATCAACCTGATTGG - Intergenic
934194777 2:89830033-89830055 TGGAATGGAATCAACCCGATTGG - Intergenic
934194865 2:89830723-89830745 AGGAATGGAATCAACTGGAGTGG - Intergenic
934195124 2:89832351-89832373 TGGAATGGAATCATCCCGAGGGG - Intergenic
934195174 2:89832638-89832660 AGGAATGGAATCAACCCGAGTGG - Intergenic
934195301 2:89833472-89833494 TGGAATGCAATCAACCCGAGTGG - Intergenic
934195559 2:89835237-89835259 AGGAATGGAATCATCACGAGTGG - Intergenic
934195837 2:89836972-89836994 AGGAATGAAATCAACCTGAGTGG + Intergenic
934196165 2:89839077-89839099 TGGAATGGAATCAACCCGATTGG + Intergenic
934196189 2:89839226-89839248 AGGAATGGAATCAACCCGAGTGG + Intergenic
934196252 2:89839675-89839697 AGGAATGGAATCAACCAGAGTGG + Intergenic
934196355 2:89840354-89840376 TGGAATGCAATCAACCCGAGTGG + Intergenic
937693766 2:124785236-124785258 ATGAATGAAATCATCCTGGTGGG + Intronic
938150442 2:128877961-128877983 ATGAATGCAATCACTAGGATGGG - Intergenic
943290348 2:186063416-186063438 AAGAATGCATTCATCTGGGTTGG - Intergenic
947395228 2:229680151-229680173 AGGAAGGCAATCATCCACAGAGG + Intronic
948106705 2:235420212-235420234 AGGAAGGCAAGCTTCCGAATGGG + Intergenic
1171914845 20:31055206-31055228 TGGAATGGAATCAACCCGATAGG + Intergenic
1171916572 20:31066251-31066273 TGGAATGGAATCAACCCGATAGG + Intergenic
1171916868 20:31068149-31068171 TGGAATGCAATCAACCCGAGTGG + Intergenic
1171917193 20:31070220-31070242 TGGAATGGAATCAACCCGATAGG + Intergenic
1171917390 20:31071428-31071450 TGGAATGGAATCAACCCGATAGG + Intergenic
1171930968 20:31228824-31228846 AGGAATGGAATCGTACGGAATGG + Intergenic
1171931021 20:31229318-31229340 AGGAATGCAATCAAATGGAATGG + Intergenic
1171931033 20:31229427-31229449 AGGAATGCAATCAAATGGAATGG + Intergenic
1174931705 20:54823178-54823200 AGGAATGCACTCATGGGGAATGG - Intergenic
1176529559 21:7947553-7947575 TGGAATGCAATCAACTGAATTGG - Intergenic
1176750953 21:10690802-10690824 AGGAATGCAATGAACTGGAATGG - Intergenic
1178353678 21:31892819-31892841 AGGAATGCAGACATCCAGAGAGG - Intronic
962023487 3:131524924-131524946 AGGAATGTTATCATCCTGTTGGG - Intergenic
965363445 3:167768811-167768833 AGGAATACCATGATCCGCATAGG + Intronic
965393643 3:168135017-168135039 AGTAATTCAATCATCAGGGTGGG + Intergenic
968551601 4:1226297-1226319 AGGAATGCAATCATCCGGATGGG - Intronic
970250408 4:14109303-14109325 AGGAATCCAATAAACTGGATTGG - Intergenic
973349393 4:49092365-49092387 TGGAATGGAATCATCCCGAGTGG - Intergenic
973350183 4:49097135-49097157 TGGAATGGAATCATCCCGAGTGG - Intergenic
973350269 4:49097648-49097670 TGGAATGGAATCATCCCGAGTGG - Intergenic
973350876 4:49101340-49101362 AGGAATGCAATCAACTGGCATGG - Intergenic
973351062 4:49102489-49102511 TGGAATGGAATCAACCGGAGTGG - Intergenic
973351287 4:49103845-49103867 CGGAATGGAATCATCCGAAGTGG - Intergenic
973351363 4:49104314-49104336 TGGAATGGAATCATCCCGAGTGG - Intergenic
973351789 4:49107103-49107125 AGGAATGCAATCAACTGGCATGG - Intergenic
973351987 4:49108306-49108328 TGGAATGGAATCAACCGGAGTGG - Intergenic
973352029 4:49108541-49108563 AGGAATGGAATCAACTGGAATGG - Intergenic
973352212 4:49109670-49109692 TGGAATGGAATCAACCGGAGTGG - Intergenic
973352351 4:49110486-49110508 TGGAATGGAATCAACCGGAGTGG - Intergenic
973352677 4:49112485-49112507 TGGAATGGAATCAACCGGAGTGG - Intergenic
973353647 4:49118476-49118498 TGGAATGGAATCATCCCGAGTGG - Intergenic
973353836 4:49119595-49119617 AGGAATGGAATCAACTGGAATGG - Intergenic
973353990 4:49120544-49120566 TGGAATGGAATCAACCGGAGTGG - Intergenic
973354075 4:49121079-49121101 TGGAATGGAATCATCCCGAGTGG - Intergenic
973354368 4:49122820-49122842 AGGAATGGAATCAACCCGAGTGG - Intergenic
973355061 4:49126935-49126957 AGGAATGGAATCAACCCGAGTGG - Intergenic
973355073 4:49127010-49127032 AGGAATGGAATCAACCCGAGTGG - Intergenic
973355144 4:49127425-49127447 TGGAATGGAATCATCCCGAGTGG - Intergenic
973355591 4:49130106-49130128 AGGAATGGAATCAACCCGAGTGG - Intergenic
973356371 4:49134762-49134784 AGGAATGGAATCAACCCGAGTGG - Intergenic
973356383 4:49134837-49134859 AGGAATGGAATCAACCCGAGTGG - Intergenic
973356450 4:49135237-49135259 TGGAATGGAATCATCCCGAGTGG - Intergenic
973356784 4:49137180-49137202 AGGAATGGAATCAACCCGAGTGG - Intergenic
973357120 4:49139129-49139151 AGGAATGGAATCAACCCGAGTGG - Intergenic
973357542 4:49141568-49141590 AGGAATGGAATCAACCCGAGTGG - Intergenic
973357926 4:49143798-49143820 AGGAATGGAATCAACCCGAGTGG - Intergenic
973358726 4:49148564-49148586 AGGAATGGAATCAACCCGAGTGG - Intergenic
973359878 4:49155325-49155347 AGGAATGGAATCAACCCGAGTGG - Intergenic
973400262 4:49632908-49632930 TGGAATGGAATCAACCGGAGTGG + Intergenic
973400271 4:49632958-49632980 TGGAATGGAATCAACCCGATTGG + Intergenic
973400406 4:49633830-49633852 AGGAATGGAATCACCCTGAGTGG + Intergenic
973400559 4:49634773-49634795 AGGAATGGAATCAACCCGAGTGG + Intergenic
973401120 4:49638329-49638351 TGGAATGCAATCAACTGGAATGG + Intergenic
973401387 4:49640020-49640042 AGGAATGGAATCACCCTGAGTGG + Intergenic
973401625 4:49641379-49641401 AGGAATGGAATCAACCCGAGTGG + Intergenic
973401891 4:49642957-49642979 TGGAATGGAATCAACCGGAGTGG + Intergenic
973401925 4:49643201-49643223 TGGAATGGAATCAACCCGATTGG + Intergenic
973401932 4:49643246-49643268 TGGAATGGAATCAACCCGATTGG + Intergenic
973402344 4:49645945-49645967 AGGAATGGAATCACCCTGAGTGG + Intergenic
973402613 4:49647523-49647545 AGGAATGGAATCAACCCGAGAGG + Intergenic
973402805 4:49648723-49648745 CGGAATGGAATCAACCGGAGTGG + Intergenic
973403434 4:49652654-49652676 AGGAATGGAATCAACCCGAGTGG + Intergenic
973404147 4:49657188-49657210 TGGAATGGAATCATCCAGAGTGG + Intergenic
973404284 4:49658058-49658080 TGGAATGGAATCATCCAGAGTGG + Intergenic
974337181 4:60564512-60564534 AGGAATGCAAACAACTGTATAGG - Intergenic
981821927 4:148897291-148897313 AGTAATTCAATCATGGGGATGGG - Intergenic
983084206 4:163424347-163424369 AGGGATGCAATCACAGGGATGGG - Intergenic
989911195 5:49657771-49657793 AGGAATGGAATCAACCCGAGTGG - Intergenic
989911202 5:49657826-49657848 TGGAATGGAATCATTCGGAGTGG - Intergenic
989911312 5:49658527-49658549 AGGAATGGAATCAACCCGAGTGG - Intergenic
989911339 5:49658692-49658714 AGGAATGGAATCAACCCGAGTGG - Intergenic
989911731 5:49661157-49661179 TGGAATGGAATCATCCCGAATGG - Intergenic
989911738 5:49661197-49661219 TGGAATGCAATCAACCCGAGTGG - Intergenic
989911754 5:49661272-49661294 AGGAATGGAATCAACCCGAGTGG - Intergenic
991240094 5:64448535-64448557 AGGAAGGAAATCATCAGGAGGGG - Intergenic
998009996 5:138687321-138687343 AGGAATACAGTCATGCGGCTGGG + Intronic
1002290516 5:178197273-178197295 AGAAATGCCATCATCCGGCAGGG + Intergenic
1006334957 6:33415594-33415616 AAGGAAGCAAACATCCGGATGGG - Exonic
1012756749 6:103241073-103241095 AGGAATGGAATGATACGGTTTGG + Intergenic
1015603419 6:134932806-134932828 CGGAATGCACTCATCCAGGTTGG + Exonic
1018453252 6:163928717-163928739 AGGAATGTGATCATTCAGATTGG + Intergenic
1023231181 7:38031341-38031363 AGGAATGCAATGTTCCTGAGAGG - Intergenic
1024459497 7:49645409-49645431 AGGAATGAAATCATCTGGGCTGG + Intergenic
1035844009 8:2843636-2843658 TGGAATGCAATCATCAAGGTAGG - Intergenic
1036474130 8:9077727-9077749 AGGAATGCAATCATCAGCCAGGG - Intronic
1038524821 8:28263738-28263760 AGGAAGGCAATACTCCAGATTGG + Intergenic
1042364508 8:67921038-67921060 AGTATTGCAATTATCAGGATTGG - Intergenic
1044799997 8:95944472-95944494 AGGATTGCAATCAGCCCTATTGG - Intergenic
1052831627 9:33220845-33220867 AGGACCACACTCATCCGGATAGG - Intronic
1059381858 9:113933195-113933217 AGGAATGGAATCAACAGAATGGG + Intronic
1060506326 9:124200903-124200925 AGGGATGAAATCATCCCAATAGG + Intergenic
1061196909 9:129111561-129111583 GGGACTGCAAGCATCCGGGTCGG + Exonic
1061567788 9:131455185-131455207 AGGGATGCACTCATGCTGATAGG - Intronic
1203720954 Un_GL000216v2:13006-13028 TGGAATGGAATCAACCTGATTGG - Intergenic
1203721211 Un_GL000216v2:14795-14817 AGGAATGGAATCAACCGGAGTGG - Intergenic
1203721886 Un_GL000216v2:19398-19420 TGGAATGGAATCAACCCGATTGG - Intergenic
1203722933 Un_GL000216v2:26795-26817 AGTAATGGAATCAACTGGATTGG - Intergenic
1203723254 Un_GL000216v2:29016-29038 TGGAATGGAATCAACCGGAATGG - Intergenic
1203723276 Un_GL000216v2:29166-29188 TGGAATGGAATCAACCCGATTGG - Intergenic
1203345454 Un_KI270442v1:30919-30941 CGGAATGCAATCAAATGGATCGG + Intergenic
1203350281 Un_KI270442v1:75943-75965 AGGAATGCAATCAAACGTAATGG + Intergenic
1203351724 Un_KI270442v1:86677-86699 TGGAATGGAATCAACCGGAGTGG + Intergenic
1203351997 Un_KI270442v1:88871-88893 TGGAATGGAATCAACCGGAGTGG + Intergenic
1203673889 Un_KI270756v1:5089-5111 AGGAATGTAATCAAACGGAATGG - Intergenic
1203680603 Un_KI270756v1:60876-60898 AGGAATGTAATCAAACGGAATGG - Intergenic
1186241069 X:7567032-7567054 AGAAATGCAACAATCCTGATGGG - Intergenic
1186245750 X:7614979-7615001 AGGATTGCAATAATCAGGAAAGG - Intergenic
1188413775 X:29906376-29906398 AGGAATCCAATAATCTGGAAGGG + Intronic
1197560754 X:128017231-128017253 AGGAATGCAGTTAGCTGGATGGG + Intergenic
1198435247 X:136610504-136610526 AGGAAAGGCATCATCCTGATGGG - Intergenic
1201174177 Y:11297702-11297724 AGGAATGGAATCAACCCGAGTGG - Intergenic
1201174724 Y:11301360-11301382 TGGAATGGAATCAACCGGAGTGG - Intergenic
1201175101 Y:11303684-11303706 AGGAATGGAATCAACAGGAATGG - Intergenic
1201195919 Y:11494516-11494538 TGGAATGCAATCATGTGGAATGG + Intergenic
1201210714 Y:11678015-11678037 AGGAATGCAATCAAATGGAATGG + Intergenic
1201213961 Y:11705887-11705909 AGGAATGCAATCAATTGGAATGG + Intergenic
1201460827 Y:14222117-14222139 AGAAATGCAACAATCCTGATGGG - Intergenic
1201464257 Y:14262827-14262849 AGTATTGCAATCATCTGGAGAGG - Intergenic
1202610386 Y:56673673-56673695 AGGAATGGAATCGTACGGAATGG + Intergenic
1202610497 Y:56674583-56674605 TGGAATGGAATCATCTGGAATGG + Intergenic
1202610802 Y:56677232-56677254 AGGAATGGAATCGTACGGAATGG + Intergenic
1202611042 Y:56679226-56679248 AGGAATGGAATCGTACGGAATGG + Intergenic
1202611152 Y:56680136-56680158 TGGAATGGAATCATCTGGAATGG + Intergenic
1202611465 Y:56682810-56682832 AGGAATGGAATCGTACGGAATGG + Intergenic
1202611576 Y:56683720-56683742 TGGAATGGAATCATCTGGAATGG + Intergenic
1202611882 Y:56686383-56686405 AGGAATGGAATCGTACGGAATGG + Intergenic
1202611991 Y:56687278-56687300 TGGAATGGAATCATCTGGAATGG + Intergenic
1202612299 Y:56689947-56689969 AGGAATGGAATCGTACGGAATGG + Intergenic
1202612412 Y:56690857-56690879 TGGAATGGAATCATCTGGAATGG + Intergenic
1202612719 Y:56693506-56693528 AGGAATGGAATCGTACGGAATGG + Intergenic
1202612831 Y:56694416-56694438 TGGAATGGAATCATCTGGAATGG + Intergenic
1202613144 Y:56697090-56697112 AGGAATGGAATCGTACGGAATGG + Intergenic
1202613253 Y:56697995-56698017 TGGAATGGAATCATCTGGAATGG + Intergenic
1202613559 Y:56700664-56700686 AGGAATGGAATCGTACGGAATGG + Intergenic
1202613671 Y:56701574-56701596 TGGAATGGAATCATCTGGAATGG + Intergenic
1202613983 Y:56704248-56704270 AGGAATGGAATCGTACGGAATGG + Intergenic
1202614094 Y:56705158-56705180 TGGAATGGAATCATCTGGAATGG + Intergenic
1202614400 Y:56707777-56707799 AGGAATGGAATCGTACGGAATGG + Intergenic
1202614509 Y:56708687-56708709 TGGAATGGAATCATCTGGAATGG + Intergenic
1202614812 Y:56711331-56711353 AGGAATGGAATCGTACGGAATGG + Intergenic
1202614924 Y:56712241-56712263 TGGAATGGAATCATCTGGAATGG + Intergenic
1202615233 Y:56714920-56714942 AGGAATGGAATCGTACGGAATGG + Intergenic
1202615342 Y:56715815-56715837 TGGAATGGAATCATCTGGAATGG + Intergenic
1202615647 Y:56718464-56718486 AGGAATGGAATCGTACGGAATGG + Intergenic
1202615759 Y:56719374-56719396 TGGAATGGAATCATCTGGAATGG + Intergenic
1202616069 Y:56722038-56722060 AGGAATGGAATCGTACGGAATGG + Intergenic
1202616179 Y:56722948-56722970 TGGAATGGAATCATCTGGAATGG + Intergenic
1202616491 Y:56725632-56725654 AGGAATGGAATCGTACGGAATGG + Intergenic
1202616603 Y:56726542-56726564 TGGAATGGAATCATCTGGAATGG + Intergenic
1202616910 Y:56729214-56729236 AGGAATGGAATCGTACGGAATGG + Intergenic
1202617021 Y:56730124-56730146 TGGAATGGAATCATCTGGAATGG + Intergenic
1202617330 Y:56732788-56732810 AGGAATGGAATCGTACGGAATGG + Intergenic
1202617441 Y:56733698-56733720 TGGAATGGAATCATCTGGAATGG + Intergenic
1202617748 Y:56736347-56736369 AGGAATGGAATCGTACGGAATGG + Intergenic
1202617857 Y:56737242-56737264 CGGAATGGAATCATCTGGAATGG + Intergenic
1202618167 Y:56739911-56739933 AGGAATGGAATCGTACGGAATGG + Intergenic
1202618278 Y:56740821-56740843 TGGAATGGAATCATCTGGAATGG + Intergenic
1202618591 Y:56743505-56743527 AGGAATGGAATCGTACGGAATGG + Intergenic
1202618699 Y:56744400-56744422 TGGAATGGAATCATCTGGAATGG + Intergenic
1202619006 Y:56747080-56747102 AGGAATGGAATCGTACGGAATGG + Intergenic
1202619118 Y:56747990-56748012 TGGAATGGAATCATCTGGAATGG + Intergenic
1202619427 Y:56750659-56750681 AGGAATGGAATCGTACGGAATGG + Intergenic
1202619538 Y:56751569-56751591 TGGAATGGAATCATCTGGAATGG + Intergenic
1202619840 Y:56754133-56754155 AGGAATGGAATCGTACGGAATGG + Intergenic
1202619950 Y:56755028-56755050 TGGAATGGAATCATCTGGAATGG + Intergenic
1202620235 Y:56757492-56757514 AGGAATGCAATGATTTGGCTTGG + Intergenic
1202620255 Y:56757667-56757689 AGGAATGGAATCGTACGGAATGG + Intergenic
1202620366 Y:56758577-56758599 TGGAATGGAATCATCTGGAATGG + Intergenic
1202620676 Y:56761256-56761278 AGGAATGGAATCGTACGGAATGG + Intergenic
1202620787 Y:56762166-56762188 TGGAATGGAATCATCTGGAATGG + Intergenic
1202621093 Y:56764820-56764842 AGGAATGGAATCGTACGGAATGG + Intergenic
1202621201 Y:56765715-56765737 CGGAATGGAATCATCTGGAATGG + Intergenic
1202621508 Y:56768378-56768400 AGGAATGGAATCGTACGGAATGG + Intergenic
1202621619 Y:56769288-56769310 TGGAATGGAATCATCTGGAATGG + Intergenic