ID: 968551602

View in Genome Browser
Species Human (GRCh38)
Location 4:1226298-1226320
Sequence CAGGAATGCAATCATCCGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 105}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968551602_968551610 9 Left 968551602 4:1226298-1226320 CCATCCGGATGATTGCATTCCTG 0: 1
1: 0
2: 0
3: 4
4: 105
Right 968551610 4:1226330-1226352 GGCCATCCGTCTCCCTGGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 127
968551602_968551621 25 Left 968551602 4:1226298-1226320 CCATCCGGATGATTGCATTCCTG 0: 1
1: 0
2: 0
3: 4
4: 105
Right 968551621 4:1226346-1226368 GGGGAGGAGGAGGGGGCAGGAGG 0: 1
1: 17
2: 169
3: 1320
4: 6809
968551602_968551608 5 Left 968551602 4:1226298-1226320 CCATCCGGATGATTGCATTCCTG 0: 1
1: 0
2: 0
3: 4
4: 105
Right 968551608 4:1226326-1226348 GACTGGCCATCCGTCTCCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 91
968551602_968551609 6 Left 968551602 4:1226298-1226320 CCATCCGGATGATTGCATTCCTG 0: 1
1: 0
2: 0
3: 4
4: 105
Right 968551609 4:1226327-1226349 ACTGGCCATCCGTCTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 138
968551602_968551615 16 Left 968551602 4:1226298-1226320 CCATCCGGATGATTGCATTCCTG 0: 1
1: 0
2: 0
3: 4
4: 105
Right 968551615 4:1226337-1226359 CGTCTCCCTGGGGAGGAGGAGGG No data
968551602_968551622 30 Left 968551602 4:1226298-1226320 CCATCCGGATGATTGCATTCCTG 0: 1
1: 0
2: 0
3: 4
4: 105
Right 968551622 4:1226351-1226373 GGAGGAGGGGGCAGGAGGCCAGG 0: 1
1: 6
2: 56
3: 388
4: 2398
968551602_968551612 12 Left 968551602 4:1226298-1226320 CCATCCGGATGATTGCATTCCTG 0: 1
1: 0
2: 0
3: 4
4: 105
Right 968551612 4:1226333-1226355 CATCCGTCTCCCTGGGGAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 234
968551602_968551620 22 Left 968551602 4:1226298-1226320 CCATCCGGATGATTGCATTCCTG 0: 1
1: 0
2: 0
3: 4
4: 105
Right 968551620 4:1226343-1226365 CCTGGGGAGGAGGAGGGGGCAGG 0: 1
1: 4
2: 39
3: 368
4: 2868
968551602_968551607 4 Left 968551602 4:1226298-1226320 CCATCCGGATGATTGCATTCCTG 0: 1
1: 0
2: 0
3: 4
4: 105
Right 968551607 4:1226325-1226347 CGACTGGCCATCCGTCTCCCTGG 0: 1
1: 0
2: 0
3: 2
4: 55
968551602_968551614 15 Left 968551602 4:1226298-1226320 CCATCCGGATGATTGCATTCCTG 0: 1
1: 0
2: 0
3: 4
4: 105
Right 968551614 4:1226336-1226358 CCGTCTCCCTGGGGAGGAGGAGG No data
968551602_968551616 17 Left 968551602 4:1226298-1226320 CCATCCGGATGATTGCATTCCTG 0: 1
1: 0
2: 0
3: 4
4: 105
Right 968551616 4:1226338-1226360 GTCTCCCTGGGGAGGAGGAGGGG 0: 1
1: 0
2: 9
3: 84
4: 1273
968551602_968551617 18 Left 968551602 4:1226298-1226320 CCATCCGGATGATTGCATTCCTG 0: 1
1: 0
2: 0
3: 4
4: 105
Right 968551617 4:1226339-1226361 TCTCCCTGGGGAGGAGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968551602 Original CRISPR CAGGAATGCAATCATCCGGA TGG (reversed) Intronic
902160801 1:14528919-14528941 CAGGAAACCAATCAGCCAGAGGG + Intergenic
914049440 1:144119401-144119423 CAGGAAGGCACTCATCCTGGTGG - Intergenic
914129744 1:144846039-144846061 CAGGAAGGCACTCATCCTGGTGG + Intergenic
916434838 1:164768420-164768442 CAGGAACCCAATCATCAAGAGGG + Intronic
916582610 1:166122162-166122184 AAGGAATGAAATCATCCCTAGGG + Intronic
917349300 1:174060281-174060303 CTGGAATGTCATCATCTGGAAGG - Intergenic
920858010 1:209678841-209678863 CAGGACTGCAAGCATCTAGAGGG + Intergenic
924552850 1:245094509-245094531 CAGGAATGCACGTATCAGGAAGG - Intronic
1067818243 10:49500585-49500607 CAAGAAGGCAATTATCTGGATGG + Exonic
1068460049 10:57317541-57317563 CAGTAATGGAATCATCCAGCTGG - Intergenic
1068923633 10:62512180-62512202 CAGGGAGGAAATCATCCTGAGGG - Intronic
1070015416 10:72524605-72524627 CAGGAACGAAATCATTCTGAAGG + Intronic
1070141573 10:73741959-73741981 CAGCAATGGAATCACCTGGAGGG + Intergenic
1071722212 10:88158546-88158568 AAGTAATGCTATCATCCCGAAGG - Intergenic
1074967579 10:118505225-118505247 TCGGAGTGCAATCATCCTGATGG - Intergenic
1077584699 11:3441849-3441871 TAGAAATGCTATCATCAGGAAGG - Intergenic
1081598083 11:44473127-44473149 CAGCAATGCAATCATACCCATGG + Intergenic
1084830839 11:71768133-71768155 TAGAAATGCTATCATCAGGAAGG + Intergenic
1089348262 11:117805797-117805819 CTGGAATGCAAGCTTCCTGAGGG - Intronic
1091257422 11:134201933-134201955 CAGTAATGTAATCATCCTCAGGG + Intronic
1092411856 12:8259184-8259206 TAGAAATGCTATCATCAGGAAGG - Intergenic
1094361312 12:29634306-29634328 ATGGAATGTAATCATCAGGAAGG + Intronic
1095280874 12:40351643-40351665 CAGGAATGCAAGCATTTGGCTGG + Exonic
1096608801 12:52787637-52787659 CAGGAGTGCAATCAACCAGATGG - Intergenic
1097389341 12:58990313-58990335 CAAGAATGCAATGATTTGGAAGG + Intergenic
1097491680 12:60279406-60279428 CAGGAAGTGAATCATCCTGAAGG - Intergenic
1100844974 12:98648742-98648764 CAGGAATGCCATCATGGAGAAGG - Exonic
1112304191 13:98258811-98258833 CAGGAATGCTGTCATCTGGTAGG + Intronic
1115100483 14:29692292-29692314 CAGGAATGGAATCATCCAACAGG - Intronic
1123419316 15:20118637-20118659 CAGGAAGGCACTCATCCTGGTGG - Intergenic
1123528538 15:21125179-21125201 CAGGAAGGCACTCATCCTGGTGG - Intergenic
1130179158 15:81607461-81607483 AAGGAATGCAATCAGGCAGAAGG - Intergenic
1133353098 16:5115416-5115438 TAGAAATGCTATCATCAGGAAGG - Intergenic
1139736468 16:68993860-68993882 CAGAAATGTAATAATCAGGAAGG - Intronic
1203137775 16_KI270728v1_random:1740085-1740107 CAGGAAGGCACTCATCCTGGTGG + Intergenic
1143831512 17:9655598-9655620 CAGGAATGCAAACACCACGAGGG + Intronic
1146515155 17:33483364-33483386 CTGGAATGCCATCAACCTGAAGG + Intronic
1147873072 17:43601451-43601473 CAGGTATGACATCATCGGGAAGG - Intergenic
1154852482 18:19828072-19828094 CTTGAATGCAAACATCCCGAAGG - Intergenic
1161113006 19:2480065-2480087 CAAGAATGGAACAATCCGGATGG - Intergenic
1164253605 19:23507608-23507630 CAGGAATGCAGTTATACGGTTGG - Intergenic
1166423755 19:42657712-42657734 CAGGTATGAAATCATGAGGATGG + Intronic
1168338113 19:55607971-55607993 CAGGAAGCCGATCATCTGGATGG + Intronic
1202688828 1_KI270712v1_random:71969-71991 CAGGAAGGCACTCATCCTGGTGG - Intergenic
928283507 2:29969174-29969196 GCGGAATGCAAACATCTGGAAGG + Intergenic
929981635 2:46686866-46686888 CAGGCCTGTAATCATCTGGACGG - Intergenic
933957607 2:87384130-87384152 CAGGAAGGCACTCATCCTGGTGG + Intergenic
934195125 2:89832352-89832374 ATGGAATGGAATCATCCCGAGGG - Intergenic
934241727 2:90276025-90276047 CAGGAAGGCACTCATCCTGGTGG + Intergenic
934271445 2:91540660-91540682 CAGGAAGGCACTCATCCTGGTGG - Intergenic
934871568 2:97871555-97871577 CAGAAATGCAAACATCTGAAAGG - Intronic
937259078 2:120573973-120573995 CAGGACTGCAATCAGCCTGGTGG - Intergenic
943240097 2:185372802-185372824 CTGGAATGTCATCATCTGGAAGG + Intergenic
945031260 2:205665696-205665718 CGGGAATGCAAACATCATGAGGG - Intergenic
945112598 2:206377084-206377106 CAGGATTGCAATAATGCGGGGGG + Intergenic
945266693 2:207897919-207897941 CAGCAATGCAAACATTAGGAAGG - Intronic
1172735075 20:37120650-37120672 CAGGAATGCTCCCATCCAGAGGG + Intronic
1180552597 22:16552628-16552650 CAGGAAGGCACTCATCCTGGTGG + Intergenic
1183193251 22:36335423-36335445 CAGGAATGCACCCAGCCGGGAGG - Intronic
1185246136 22:49774319-49774341 GAGGAATTCCAGCATCCGGAAGG - Exonic
954127961 3:48543322-48543344 CAAGAATACAAGCATCCAGAGGG + Intronic
961375532 3:126462971-126462993 CAGGACTGCAAGCCTCCTGAGGG + Intronic
961889403 3:130117793-130117815 TAGAAATGCTATCATCAGGAAGG - Intergenic
962023488 3:131524925-131524947 CAGGAATGTTATCATCCTGTTGG - Intergenic
966886012 3:184378539-184378561 CAGGAAAGCAAGCATCCTGTTGG - Intronic
968551602 4:1226298-1226320 CAGGAATGCAATCATCCGGATGG - Intronic
969754123 4:9136937-9136959 CAGAAATTCTATCATCAGGAAGG + Intergenic
969814014 4:9673165-9673187 TAGAAATGCTATCATCAGGAAGG + Intergenic
971465799 4:26959300-26959322 CAGGAATGCACACATCCTCATGG + Intronic
977120885 4:93099807-93099829 TAGGAATGCATTCATGAGGATGG - Intronic
982453366 4:155578333-155578355 CAGTAATGAAATCATCCGAAAGG + Intergenic
982551122 4:156801104-156801126 CAGAAATGCAAACGTCTGGAAGG - Intronic
983571386 4:169211836-169211858 CAGGAGTGCAGTTATCCAGATGG - Intronic
984719766 4:182958868-182958890 GAGGCAAGCAATCATCCAGAAGG + Intergenic
984848432 4:184129099-184129121 CAGGAATGCTATCATCACCATGG + Intronic
986549973 5:8941798-8941820 CTGGAATGCCATCAGCTGGAAGG - Intergenic
988417607 5:30965899-30965921 CAGGAATGAAAACATCCCTATGG + Intergenic
991240095 5:64448536-64448558 GAGGAAGGAAATCATCAGGAGGG - Intergenic
992205572 5:74427453-74427475 CAGGACTGCATTCCTTCGGAAGG + Intergenic
996257071 5:121417387-121417409 CAGGAATGAAATCATGGAGAAGG - Intergenic
997119087 5:131156071-131156093 CAGGACTGCAGTCATCTTGAAGG + Intergenic
998581112 5:143377074-143377096 AAGGAATGAAATCATAAGGATGG - Intronic
1002290515 5:178197272-178197294 TAGAAATGCCATCATCCGGCAGG + Intergenic
1003846829 6:10182480-10182502 CAGGAATGCCAGCATGTGGAAGG + Intronic
1005655684 6:27934486-27934508 CAGGAATGCAATCCTCACAAAGG + Intergenic
1007434104 6:41796123-41796145 CAGGACTGCTCACATCCGGAGGG + Exonic
1008051810 6:46907957-46907979 CCAGAATGCAACCATCCAGAAGG + Intronic
1010575970 6:77531520-77531542 TAGAAATGTAATCATCAGGAAGG - Intergenic
1015206856 6:130650202-130650224 CAAGGATACAATCATCCTGAGGG - Intergenic
1015339767 6:132084960-132084982 CAGGAATGAAATACTCAGGAAGG - Intergenic
1018169056 6:161129758-161129780 GAGGAATGCAGTCATAAGGAGGG + Intergenic
1019763865 7:2835040-2835062 CACTAATGCAATCATGTGGATGG + Intronic
1026235584 7:68524099-68524121 CAGCTTTGCAATCATCCGAAAGG - Intergenic
1026331657 7:69357323-69357345 CAGGAAGGCAGTCAGCTGGAAGG - Intergenic
1036377339 8:8212259-8212281 TAGAAATGCTATCATCAGGAAGG + Intergenic
1036474131 8:9077728-9077750 GAGGAATGCAATCATCAGCCAGG - Intronic
1036852212 8:12210892-12210914 TAGAAATGCTATCATCAGGAAGG - Intergenic
1036873579 8:12453413-12453435 TAGAAATGCTATCATCAGGAAGG - Intergenic
1037136957 8:15474040-15474062 CAGGAATGCATTCTTCCCCACGG + Intronic
1037279956 8:17228975-17228997 CAGGAATGCATTTATTCCGAAGG - Intergenic
1037940741 8:22949074-22949096 CAGGAATGCAATCTGATGGAGGG + Intronic
1045916649 8:107480049-107480071 CTGGAATGCAATCTTCTGGAAGG + Intronic
1049641667 8:143718782-143718804 CCTGAACGCAGTCATCCGGAAGG + Exonic
1056488025 9:87078338-87078360 CAGGAATATAAGCATCAGGAGGG + Intergenic
1057000604 9:91505214-91505236 CAGGAAGGGAAGCATCTGGAGGG + Intergenic
1060689676 9:125645877-125645899 CTGGAATGCAAACACCTGGAAGG + Intronic
1188350594 X:29125987-29126009 CATAAATGCAATTATCCGCATGG - Intronic
1188413774 X:29906375-29906397 CAGGAATCCAATAATCTGGAAGG + Intronic
1198401658 X:136274511-136274533 CCGGAATGAAATCAACCAGATGG - Intergenic
1199057945 X:143319523-143319545 CAGGGATCCATCCATCCGGAGGG - Intergenic