ID: 968551603

View in Genome Browser
Species Human (GRCh38)
Location 4:1226302-1226324
Sequence GACACAGGAATGCAATCATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 144}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968551603_968551612 8 Left 968551603 4:1226302-1226324 CCGGATGATTGCATTCCTGTGTC 0: 1
1: 0
2: 2
3: 9
4: 144
Right 968551612 4:1226333-1226355 CATCCGTCTCCCTGGGGAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 234
968551603_968551614 11 Left 968551603 4:1226302-1226324 CCGGATGATTGCATTCCTGTGTC 0: 1
1: 0
2: 2
3: 9
4: 144
Right 968551614 4:1226336-1226358 CCGTCTCCCTGGGGAGGAGGAGG No data
968551603_968551610 5 Left 968551603 4:1226302-1226324 CCGGATGATTGCATTCCTGTGTC 0: 1
1: 0
2: 2
3: 9
4: 144
Right 968551610 4:1226330-1226352 GGCCATCCGTCTCCCTGGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 127
968551603_968551616 13 Left 968551603 4:1226302-1226324 CCGGATGATTGCATTCCTGTGTC 0: 1
1: 0
2: 2
3: 9
4: 144
Right 968551616 4:1226338-1226360 GTCTCCCTGGGGAGGAGGAGGGG 0: 1
1: 0
2: 9
3: 84
4: 1273
968551603_968551621 21 Left 968551603 4:1226302-1226324 CCGGATGATTGCATTCCTGTGTC 0: 1
1: 0
2: 2
3: 9
4: 144
Right 968551621 4:1226346-1226368 GGGGAGGAGGAGGGGGCAGGAGG 0: 1
1: 17
2: 169
3: 1320
4: 6809
968551603_968551607 0 Left 968551603 4:1226302-1226324 CCGGATGATTGCATTCCTGTGTC 0: 1
1: 0
2: 2
3: 9
4: 144
Right 968551607 4:1226325-1226347 CGACTGGCCATCCGTCTCCCTGG 0: 1
1: 0
2: 0
3: 2
4: 55
968551603_968551615 12 Left 968551603 4:1226302-1226324 CCGGATGATTGCATTCCTGTGTC 0: 1
1: 0
2: 2
3: 9
4: 144
Right 968551615 4:1226337-1226359 CGTCTCCCTGGGGAGGAGGAGGG No data
968551603_968551608 1 Left 968551603 4:1226302-1226324 CCGGATGATTGCATTCCTGTGTC 0: 1
1: 0
2: 2
3: 9
4: 144
Right 968551608 4:1226326-1226348 GACTGGCCATCCGTCTCCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 91
968551603_968551622 26 Left 968551603 4:1226302-1226324 CCGGATGATTGCATTCCTGTGTC 0: 1
1: 0
2: 2
3: 9
4: 144
Right 968551622 4:1226351-1226373 GGAGGAGGGGGCAGGAGGCCAGG 0: 1
1: 6
2: 56
3: 388
4: 2398
968551603_968551617 14 Left 968551603 4:1226302-1226324 CCGGATGATTGCATTCCTGTGTC 0: 1
1: 0
2: 2
3: 9
4: 144
Right 968551617 4:1226339-1226361 TCTCCCTGGGGAGGAGGAGGGGG No data
968551603_968551620 18 Left 968551603 4:1226302-1226324 CCGGATGATTGCATTCCTGTGTC 0: 1
1: 0
2: 2
3: 9
4: 144
Right 968551620 4:1226343-1226365 CCTGGGGAGGAGGAGGGGGCAGG 0: 1
1: 4
2: 39
3: 368
4: 2868
968551603_968551609 2 Left 968551603 4:1226302-1226324 CCGGATGATTGCATTCCTGTGTC 0: 1
1: 0
2: 2
3: 9
4: 144
Right 968551609 4:1226327-1226349 ACTGGCCATCCGTCTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968551603 Original CRISPR GACACAGGAATGCAATCATC CGG (reversed) Intronic
905887444 1:41499031-41499053 GGCACAGGAATGCAGACAGCTGG - Intergenic
906933402 1:50190887-50190909 GACAGAGGAAGGCTATTATCAGG + Intronic
907626386 1:56034464-56034486 GAAATAGGAAGGCAAACATCTGG + Intergenic
912130280 1:106590961-106590983 AACACAGGAATTCTATCACCTGG - Intergenic
916265195 1:162883559-162883581 GAAACGGGAAGGCAACCATCAGG - Intergenic
916459728 1:165011023-165011045 TCCACAGGATTGCAAACATCTGG + Intergenic
918080603 1:181204959-181204981 GAAACATGGATGGAATCATCGGG + Intergenic
918851123 1:189692365-189692387 GACATAGGAATGAAAGCACCAGG - Intergenic
920228869 1:204457256-204457278 GACGGAGGATAGCAATCATCGGG + Intronic
920819544 1:209367595-209367617 GCCACAGGAATGAAAACTTCTGG + Intergenic
921752001 1:218805803-218805825 GACCCAGGAATGCATTCAATAGG + Intergenic
923242160 1:232096720-232096742 GACAAAGAAATGCAATCAGAAGG - Intergenic
923668031 1:236015763-236015785 GTCACAGGAAACCAATGATCCGG + Intronic
924721922 1:246631403-246631425 GAAACAGGAATGAAATCAATAGG + Intronic
924937249 1:248782528-248782550 CACACAGGAAGGCCATCATTTGG + Intergenic
1064716255 10:18179962-18179984 AGCACAGGAATGGAATCTTCAGG - Intronic
1068754174 10:60632021-60632043 GACACAGGAATGGAACCAGTTGG + Intronic
1071513483 10:86282011-86282033 GACACTGGCATCCAGTCATCTGG + Intronic
1071815198 10:89225248-89225270 AAAACAGGAATTCCATCATCTGG + Intronic
1079154069 11:17927696-17927718 AACACAGAATTGAAATCATCTGG + Intronic
1081034102 11:38119846-38119868 GACACAGAAATGAAATAATTTGG + Intergenic
1089904510 11:122024663-122024685 GAAACAGGGATACACTCATCTGG + Intergenic
1090597053 11:128331107-128331129 GCTACAGGAATGCAAACACCTGG + Intergenic
1091829133 12:3536738-3536760 GACACCGGAGTGCAATGCTCGGG + Intronic
1095331864 12:40975831-40975853 GAAAGAGGAATTCAATCAGCTGG + Intronic
1095543749 12:43341339-43341361 GACACATGAAGAGAATCATCTGG - Intergenic
1098510434 12:71307047-71307069 GACACAGGTATAAAACCATCTGG + Intronic
1100589218 12:96009645-96009667 TAAAAAGGAATGAAATCATCAGG - Intronic
1103361042 12:120353828-120353850 GACTCAGGCATGTAGTCATCTGG - Intronic
1103882412 12:124176250-124176272 GACACAGGATTGCAATGAAAAGG + Intronic
1105024936 12:132841805-132841827 GAAACAGAAGTGCAAACATCTGG + Intronic
1105201023 13:18178143-18178165 GAAACAGAAATGCAATCATGTGG - Intergenic
1106290411 13:28356068-28356090 GACAGGGGAATGCAGTCATGGGG + Intronic
1108526723 13:51291849-51291871 GACACAGGAATGTGATAATGGGG - Intergenic
1108816520 13:54298526-54298548 GACCCAGCAATGCCATCATTGGG + Intergenic
1109403923 13:61873251-61873273 GACACATGAATGGAAAAATCTGG - Intergenic
1109759468 13:66808606-66808628 GAAAATTGAATGCAATCATCTGG - Intronic
1110649143 13:77922797-77922819 GTCACAGGATTGCAAACATTTGG - Intergenic
1111702661 13:91710606-91710628 AATTCAGGAATGCAAACATCAGG + Intronic
1111808363 13:93066445-93066467 GAAAGAGGGATGAAATCATCAGG + Intergenic
1112304188 13:98258807-98258829 AACCCAGGAATGCTGTCATCTGG + Intronic
1113698501 13:112365533-112365555 GAGACAGGAATCCCATCATGGGG - Intergenic
1113791636 13:113032075-113032097 GAAACACGAATGTAATCATTAGG + Intronic
1114583711 14:23789889-23789911 GACACAGCAATGTTATTATCAGG + Intergenic
1115154338 14:30321079-30321101 GATACAGCAATGCATTCATCTGG - Intergenic
1120128490 14:80776195-80776217 AACACATTAATGCAATCTTCTGG + Intronic
1120422500 14:84305814-84305836 CCCACAGAGATGCAATCATCAGG + Intergenic
1121571869 14:94952256-94952278 GACACAGGCCTGCATTCATATGG + Intergenic
1122394611 14:101414719-101414741 GACAAAGAAATGGAATCATGTGG + Intergenic
1124709323 15:31992532-31992554 GAGACAGTACTGCACTCATCTGG - Intergenic
1125286696 15:38100933-38100955 GAAACAGGAATGCTATTATATGG + Intergenic
1132009471 15:98263050-98263072 GACACAGGCATGCAAGCATCAGG + Intergenic
1133440702 16:5818777-5818799 GACACAGGGATCCAATGCTCAGG - Intergenic
1136418546 16:30117938-30117960 GACACAGGAATTCTACCCTCTGG - Intronic
1138617758 16:58184407-58184429 AACACAGGGATTCACTCATCAGG + Intronic
1141803204 16:86324670-86324692 GACAGACGAATGCAATAATTAGG - Intergenic
1142711542 17:1726421-1726443 AACTCCGGAATGCACTCATCCGG - Exonic
1144827288 17:18112748-18112770 GACTCAGAAATGCATTCATATGG + Intronic
1145771062 17:27493530-27493552 AAGACAGAAATGGAATCATCAGG - Intronic
1145845025 17:28031111-28031133 GTCACTGGAAGGCAATCAACTGG + Intergenic
1146954194 17:36927471-36927493 AACACAGGAAAGCAAGCATAGGG - Intergenic
1158314987 18:56202141-56202163 GAAACAGGAATGAAATGAGCAGG - Intergenic
1159333164 18:67028786-67028808 CACACATGGATGAAATCATCAGG + Intergenic
1159828298 18:73242140-73242162 AAAAAAGAAATGCAATCATCAGG - Intronic
1162963120 19:14140226-14140248 GAGACAGCCATGCAATTATCTGG - Intergenic
1164548772 19:29190601-29190623 AACACAGGAAAGCAAGCAGCCGG + Intergenic
1167284170 19:48589393-48589415 GGCACAGAAATGCACCCATCGGG + Intronic
932896946 2:75649498-75649520 TACAAAGGTATCCAATCATCTGG - Intronic
933278297 2:80305138-80305160 GACACAGGAAGGCAATGATTTGG + Intronic
934059512 2:88281203-88281225 AACACAGGAAAGGAAGCATCTGG + Intergenic
940470247 2:154088845-154088867 AACACAATAATGCAATCAGCTGG - Intronic
941204296 2:162552491-162552513 GACAGAGGAATGAAATCTTGGGG - Intronic
941685918 2:168448610-168448632 GAAACAGAAAAGCAATTATCTGG - Intergenic
944408301 2:199410744-199410766 TACACAGGAATGACATCATAAGG + Intronic
945112594 2:206377080-206377102 GAGACAGGATTGCAATAATGCGG + Intergenic
945220190 2:207475717-207475739 GACACAGGCATGCAGGCAGCAGG - Intergenic
945338070 2:208616674-208616696 CACACAGGCATGTAATCATCAGG - Intronic
1169941013 20:10937550-10937572 GACAAAGAAAAGCAATCATTGGG - Intergenic
1171018476 20:21562812-21562834 GAAAAAGAAATGCAATTATCAGG + Intergenic
1174114150 20:48215396-48215418 GACACAAGAATCCCACCATCAGG - Intergenic
1177039258 21:16086415-16086437 GACTCAGGAACCTAATCATCAGG + Intergenic
1177901977 21:26927684-26927706 ATCAAAGGAATGCAATGATCTGG + Intronic
1178699266 21:34819632-34819654 GTCACAGGGATGCCTTCATCTGG + Intronic
1178903126 21:36613604-36613626 GAAAAAGGAATGAAATCATAGGG + Intergenic
1184885272 22:47341222-47341244 GACACATGAATGCCATCAGGAGG - Intergenic
1185049673 22:48547397-48547419 TACAAAGGAATGCAAACACCTGG - Intronic
950828583 3:15851768-15851790 GATATAGGAATGGAATCATTGGG - Intronic
952987313 3:38797752-38797774 GACACTGGAATGCAATGTTGAGG + Intergenic
954366007 3:50146551-50146573 GCCACATGAATGCATTCCTCTGG + Intergenic
954801143 3:53187552-53187574 GCCACAGGAATGCTAACACCAGG - Intronic
955131659 3:56175440-56175462 GGCACTGGACTGCAATCATCTGG + Intronic
957224241 3:77422898-77422920 GCCACTGGAAAGCAATCATTTGG + Intronic
957521812 3:81328284-81328306 GATACAGGCATGCAATCCTTTGG - Intergenic
959327949 3:104961748-104961770 GATATAGGAAAGCAATCAGCAGG + Intergenic
959732855 3:109623710-109623732 GTCACAGGTAAGCAAACATCTGG + Intergenic
960347424 3:116551278-116551300 GACACAGCAATCCAATTATTGGG - Intronic
960883346 3:122368649-122368671 AACACATGAATGGAATCATGGGG - Intronic
962778593 3:138688679-138688701 GACAAAAGAATGTATTCATCAGG + Intronic
964389705 3:156184523-156184545 GACAGAGGAATGCAATATGCTGG + Intronic
966213351 3:177475843-177475865 AACACAGTAATGCAATAATTGGG - Intergenic
967317058 3:188159642-188159664 GCCACAGGATAGCAATCATGGGG + Intronic
968551603 4:1226302-1226324 GACACAGGAATGCAATCATCCGG - Intronic
975270574 4:72427509-72427531 GGCACAAGAATGCATTTATCAGG + Intronic
975961553 4:79913939-79913961 GACACAGGCATGAAAATATCTGG - Intronic
977044094 4:92047504-92047526 GCCACAGAAATGTTATCATCAGG + Intergenic
978429305 4:108617007-108617029 GACACATGAAATTAATCATCAGG - Intergenic
983566246 4:169155248-169155270 GACACAGGAATGCTTTTAGCAGG + Intronic
985330226 4:188823818-188823840 GACACAGGGATGCACACATAGGG + Intergenic
986079133 5:4371321-4371343 AGAACATGAATGCAATCATCTGG - Intergenic
989038667 5:37203261-37203283 GCCACAGAAATGGAATCATACGG + Intronic
989362733 5:40622390-40622412 GAAACAGGAATGCATTTATCAGG - Intergenic
990119435 5:52431883-52431905 GAGAGAGGTATGAAATCATCAGG - Intergenic
991532678 5:67633154-67633176 GACACAGGAGAGCAACCATAGGG + Intergenic
994082596 5:95724149-95724171 GACACAGCAATACAGTTATCTGG + Intronic
995286307 5:110392536-110392558 TACACAGGAATGTAATTGTCAGG - Intronic
997107700 5:131039926-131039948 TACTCAGGAATGCCATCAACTGG + Intergenic
998110909 5:139501827-139501849 CATCCAGGGATGCAATCATCTGG - Intergenic
999310193 5:150546842-150546864 GCCACAGGAAAGCAGACATCAGG - Intronic
1000563243 5:162816542-162816564 GACACAGGAAGGGGAACATCAGG - Intergenic
1004086089 6:12451084-12451106 GAGACAGCCATGCAATAATCTGG + Intergenic
1004580022 6:16941005-16941027 GACACAGGAAGTCAAGCATATGG - Intergenic
1008959614 6:57253023-57253045 GTCACAGGAATGTAAACATGGGG - Intergenic
1009590918 6:65669825-65669847 CACACAGGAATGGCATGATCTGG + Intronic
1011420229 6:87164198-87164220 GACATATGAATGAAACCATCTGG - Intronic
1018334268 6:162768971-162768993 GACACAGGAAGTTAATCAACAGG - Intronic
1019132078 6:169884327-169884349 CACACAGGAGGGCACTCATCTGG + Intergenic
1019638756 7:2091086-2091108 GCCACAGGAATGCTTTCCTCTGG + Intronic
1022921371 7:35018884-35018906 GAGAGAGGAATGGAATCAACAGG + Intronic
1024459495 7:49645404-49645426 GACATAGGAATGAAATCATCTGG + Intergenic
1027438027 7:78186956-78186978 GACACATGTATGCAAACCTCTGG + Intronic
1028515005 7:91668413-91668435 AACAGAGGAAAGCAATCATTAGG + Intergenic
1030327324 7:108234257-108234279 GGCACAGAAATGCAATAATCTGG + Intronic
1036793149 8:11736655-11736677 GACAGAGGAATGCAATTGACTGG - Intronic
1039376777 8:37042524-37042546 GACACAGGCATCCAGCCATCAGG + Intergenic
1041501098 8:58539624-58539646 GACTCAGGAATGCAATTAGGAGG + Intergenic
1041759979 8:61355593-61355615 GACACAGGAAAGGGAACATCAGG - Intronic
1046087499 8:109456385-109456407 GACACAGGTATGATATCTTCTGG + Exonic
1046315445 8:112495401-112495423 GAAACTGTAATGCAAGCATCCGG + Intronic
1046806079 8:118480508-118480530 GACCCAGTAATGCAAACAACAGG + Intronic
1047901022 8:129422636-129422658 GACACAGGACTGCAATTCTTAGG + Intergenic
1050377897 9:4992125-4992147 GGCAAAGGACTGGAATCATCTGG + Intronic
1055452302 9:76441819-76441841 ACAACTGGAATGCAATCATCAGG + Exonic
1056980982 9:91311825-91311847 TACACAGCAATGAAATTATCAGG - Intronic
1058223126 9:102326634-102326656 GGCACAGGAGTGCAATGATATGG + Intergenic
1058680464 9:107436299-107436321 GACACAGGTATGCAGCCATGAGG + Intergenic
1058891260 9:109362743-109362765 GACCCAGCAATTCAACCATCAGG - Intergenic
1059950542 9:119457682-119457704 GACAAAGGAACGGAATAATCTGG - Intergenic
1060017487 9:120099191-120099213 GACACAGGAAGGCCATTATCTGG - Intergenic
1060689675 9:125645873-125645895 GACTCTGGAATGCAAACACCTGG + Intronic
1061349125 9:130050179-130050201 GACTCAAGAAAGCAATCAACTGG + Intergenic
1062194012 9:135263358-135263380 GCCACAGAAATGCACTCTTCGGG - Intergenic
1203583335 Un_KI270746v1:35793-35815 GAAACAGAAATGCAATCATGTGG + Intergenic
1191105887 X:56772030-56772052 TACACAGGCACGCAATCATATGG + Intergenic
1191106880 X:56777432-56777454 TACACAGGCACGCAATCATATGG + Intergenic
1193947654 X:87758032-87758054 GACACAGTAATGAGATCATTGGG + Intergenic
1195132528 X:101867835-101867857 GACACAGGAAGGGGAACATCAGG + Intergenic