ID: 968551604

View in Genome Browser
Species Human (GRCh38)
Location 4:1226309-1226331
Sequence ATTGCATTCCTGTGTCCGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 50}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968551589_968551604 25 Left 968551589 4:1226261-1226283 CCCTGGCCAGGGCCGCCCCTGCA 0: 1
1: 0
2: 1
3: 36
4: 424
Right 968551604 4:1226309-1226331 ATTGCATTCCTGTGTCCGACTGG 0: 1
1: 0
2: 0
3: 0
4: 50
968551594_968551604 10 Left 968551594 4:1226276-1226298 CCCCTGCACGGCACTTCCCACCC 0: 1
1: 1
2: 2
3: 23
4: 305
Right 968551604 4:1226309-1226331 ATTGCATTCCTGTGTCCGACTGG 0: 1
1: 0
2: 0
3: 0
4: 50
968551590_968551604 24 Left 968551590 4:1226262-1226284 CCTGGCCAGGGCCGCCCCTGCAC 0: 1
1: 0
2: 5
3: 38
4: 497
Right 968551604 4:1226309-1226331 ATTGCATTCCTGTGTCCGACTGG 0: 1
1: 0
2: 0
3: 0
4: 50
968551593_968551604 13 Left 968551593 4:1226273-1226295 CCGCCCCTGCACGGCACTTCCCA 0: 1
1: 0
2: 3
3: 25
4: 303
Right 968551604 4:1226309-1226331 ATTGCATTCCTGTGTCCGACTGG 0: 1
1: 0
2: 0
3: 0
4: 50
968551599_968551604 -7 Left 968551599 4:1226293-1226315 CCACCCCATCCGGATGATTGCAT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 968551604 4:1226309-1226331 ATTGCATTCCTGTGTCCGACTGG 0: 1
1: 0
2: 0
3: 0
4: 50
968551598_968551604 -6 Left 968551598 4:1226292-1226314 CCCACCCCATCCGGATGATTGCA 0: 1
1: 0
2: 0
3: 5
4: 84
Right 968551604 4:1226309-1226331 ATTGCATTCCTGTGTCCGACTGG 0: 1
1: 0
2: 0
3: 0
4: 50
968551596_968551604 8 Left 968551596 4:1226278-1226300 CCTGCACGGCACTTCCCACCCCA 0: 1
1: 0
2: 3
3: 17
4: 308
Right 968551604 4:1226309-1226331 ATTGCATTCCTGTGTCCGACTGG 0: 1
1: 0
2: 0
3: 0
4: 50
968551592_968551604 19 Left 968551592 4:1226267-1226289 CCAGGGCCGCCCCTGCACGGCAC 0: 1
1: 0
2: 1
3: 18
4: 235
Right 968551604 4:1226309-1226331 ATTGCATTCCTGTGTCCGACTGG 0: 1
1: 0
2: 0
3: 0
4: 50
968551600_968551604 -10 Left 968551600 4:1226296-1226318 CCCCATCCGGATGATTGCATTCC 0: 1
1: 0
2: 4
3: 46
4: 187
Right 968551604 4:1226309-1226331 ATTGCATTCCTGTGTCCGACTGG 0: 1
1: 0
2: 0
3: 0
4: 50
968551595_968551604 9 Left 968551595 4:1226277-1226299 CCCTGCACGGCACTTCCCACCCC 0: 1
1: 1
2: 2
3: 23
4: 311
Right 968551604 4:1226309-1226331 ATTGCATTCCTGTGTCCGACTGG 0: 1
1: 0
2: 0
3: 0
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968551604 Original CRISPR ATTGCATTCCTGTGTCCGAC TGG Intronic