ID: 968551604

View in Genome Browser
Species Human (GRCh38)
Location 4:1226309-1226331
Sequence ATTGCATTCCTGTGTCCGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 50}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968551598_968551604 -6 Left 968551598 4:1226292-1226314 CCCACCCCATCCGGATGATTGCA 0: 1
1: 0
2: 0
3: 5
4: 84
Right 968551604 4:1226309-1226331 ATTGCATTCCTGTGTCCGACTGG 0: 1
1: 0
2: 0
3: 0
4: 50
968551589_968551604 25 Left 968551589 4:1226261-1226283 CCCTGGCCAGGGCCGCCCCTGCA 0: 1
1: 0
2: 1
3: 36
4: 424
Right 968551604 4:1226309-1226331 ATTGCATTCCTGTGTCCGACTGG 0: 1
1: 0
2: 0
3: 0
4: 50
968551595_968551604 9 Left 968551595 4:1226277-1226299 CCCTGCACGGCACTTCCCACCCC 0: 1
1: 1
2: 2
3: 23
4: 311
Right 968551604 4:1226309-1226331 ATTGCATTCCTGTGTCCGACTGG 0: 1
1: 0
2: 0
3: 0
4: 50
968551596_968551604 8 Left 968551596 4:1226278-1226300 CCTGCACGGCACTTCCCACCCCA 0: 1
1: 0
2: 3
3: 17
4: 308
Right 968551604 4:1226309-1226331 ATTGCATTCCTGTGTCCGACTGG 0: 1
1: 0
2: 0
3: 0
4: 50
968551600_968551604 -10 Left 968551600 4:1226296-1226318 CCCCATCCGGATGATTGCATTCC 0: 1
1: 0
2: 4
3: 46
4: 187
Right 968551604 4:1226309-1226331 ATTGCATTCCTGTGTCCGACTGG 0: 1
1: 0
2: 0
3: 0
4: 50
968551594_968551604 10 Left 968551594 4:1226276-1226298 CCCCTGCACGGCACTTCCCACCC 0: 1
1: 1
2: 2
3: 23
4: 305
Right 968551604 4:1226309-1226331 ATTGCATTCCTGTGTCCGACTGG 0: 1
1: 0
2: 0
3: 0
4: 50
968551590_968551604 24 Left 968551590 4:1226262-1226284 CCTGGCCAGGGCCGCCCCTGCAC 0: 1
1: 0
2: 5
3: 38
4: 497
Right 968551604 4:1226309-1226331 ATTGCATTCCTGTGTCCGACTGG 0: 1
1: 0
2: 0
3: 0
4: 50
968551592_968551604 19 Left 968551592 4:1226267-1226289 CCAGGGCCGCCCCTGCACGGCAC 0: 1
1: 0
2: 1
3: 18
4: 235
Right 968551604 4:1226309-1226331 ATTGCATTCCTGTGTCCGACTGG 0: 1
1: 0
2: 0
3: 0
4: 50
968551599_968551604 -7 Left 968551599 4:1226293-1226315 CCACCCCATCCGGATGATTGCAT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 968551604 4:1226309-1226331 ATTGCATTCCTGTGTCCGACTGG 0: 1
1: 0
2: 0
3: 0
4: 50
968551593_968551604 13 Left 968551593 4:1226273-1226295 CCGCCCCTGCACGGCACTTCCCA 0: 1
1: 0
2: 3
3: 25
4: 303
Right 968551604 4:1226309-1226331 ATTGCATTCCTGTGTCCGACTGG 0: 1
1: 0
2: 0
3: 0
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968551604 Original CRISPR ATTGCATTCCTGTGTCCGAC TGG Intronic
907641058 1:56190832-56190854 GTTGAATTCCTGTTTCCCACAGG - Intergenic
910517527 1:88079075-88079097 ATTTCATTCCTGTGCCAGCCTGG - Intergenic
1068601731 10:58964013-58964035 TTTGCATTCCTGGGGCCCACTGG + Intergenic
1070553667 10:77511990-77512012 CTTGCATTCCTCTGTCAGCCTGG + Intronic
1072082392 10:92045212-92045234 ATTGCATGGCTGTGCGCGACAGG - Intergenic
1084738239 11:71120007-71120029 ATTGCTTTCCTGTGTCCTTTGGG - Intronic
1103397741 12:120620938-120620960 ATTGTCTTCCTGTGTAAGACAGG + Intergenic
1104302447 12:127576700-127576722 ATTTCATTCCTGTCGCAGACTGG + Intergenic
1112767132 13:102757156-102757178 CTGGCATTCCTGTTTCCAACTGG + Intronic
1112859935 13:103818156-103818178 ATTGCATACCTCTGTTCAACGGG - Intergenic
1116860020 14:49987445-49987467 ATTCCTTTTCTGTGACCGACTGG - Intronic
1121114645 14:91335174-91335196 ACTGCTTTCCTGAGTCCCACCGG - Intronic
1122837277 14:104436446-104436468 ACTGCATGCCTGTGTCTGGCTGG + Intergenic
1138065229 16:53934024-53934046 ATTTCATTCCTTTGTTCCACGGG - Exonic
1140917280 16:79505731-79505753 CTTGCATTCCTGTGGCCAAACGG + Intergenic
1142734638 17:1888739-1888761 ATTGCAGTCCTGAGTCGGGCAGG - Exonic
1146896438 17:36545188-36545210 ACTGCAGTCCTGGGGCCGACTGG + Intronic
1149503971 17:57177684-57177706 ATTGAATTGCTGTGTCAGGCCGG + Intergenic
1155996438 18:32335555-32335577 ATTGCATTGCTCTGTCCAAAGGG - Intronic
1156562844 18:38148164-38148186 ATAGCAATCCTGTGTTCCACAGG - Intergenic
1160061023 18:75528919-75528941 TTTGCATTCCTGTCTCCGTTGGG - Intergenic
925873755 2:8294020-8294042 TTTGCATTCCTGTATCAGCCAGG + Intergenic
927247991 2:20973505-20973527 ACTCCATTCCTGTGTCAGAAGGG + Intergenic
928025650 2:27736540-27736562 CTTGCATTCCTGTGGCAGCCAGG + Intergenic
929592675 2:43157495-43157517 ATTGCATCCCTGTGACCTCCCGG + Intergenic
935187594 2:100748124-100748146 ATTGCAGTCCTGTGCCAGGCAGG + Intergenic
947936233 2:234006621-234006643 ATTGCATTCCTATTTCACACAGG + Intronic
1173096291 20:40031806-40031828 ATTGCATTGCTGTGGCCCAAGGG - Intergenic
1175171854 20:57086340-57086362 GTTGCCTTCCTGTGTCCTAACGG - Intergenic
1177000102 21:15601719-15601741 ATTGCATTCTTGAGTCTGAAGGG - Intergenic
955523558 3:59798402-59798424 ATAGCATTCATGTGTCTGAGAGG - Intronic
962667469 3:137669549-137669571 TTTGCATTCCTGTGTCATCCTGG + Intergenic
968551604 4:1226309-1226331 ATTGCATTCCTGTGTCCGACTGG + Intronic
970231067 4:13911767-13911789 ATTGCATTGCTGTGTGGGGCAGG - Intergenic
970980335 4:22089021-22089043 CTTGCATTTCTGTGTCCTATTGG - Intergenic
979546858 4:121950216-121950238 ATTGTGTTCCTGTGTTCTACCGG + Intronic
993446525 5:88019115-88019137 ATAGGATTACTGTGTCCCACAGG + Intergenic
1011494579 6:87925663-87925685 GTTGCATCCCTGTGTCTGGCAGG - Intergenic
1011618221 6:89217544-89217566 GTTGAATTCCTGTGTCCCAGTGG + Intronic
1012094404 6:94940428-94940450 ATTGCGTTCCTTTGACCCACTGG - Intergenic
1013869214 6:114736679-114736701 ATTGCTTTCCTGTGCCAAACTGG - Intergenic
1018056225 6:160054630-160054652 ATTGCATTCCTGTCCATGACGGG - Intronic
1018504438 6:164449315-164449337 ATTGCATTTCTATTTCCTACTGG - Intergenic
1030569017 7:111198124-111198146 ATTGCATTCTTGTGTCCTGGAGG - Intronic
1034827892 7:154283126-154283148 ATTGCATTACTGGGGCCCACGGG - Intronic
1037316027 8:17600288-17600310 TTTGCAGTCCTGTGTCCTTCTGG + Intronic
1038101971 8:24387868-24387890 AGTGCATACCTGTGTCTGAATGG - Intronic
1039522986 8:38187663-38187685 ATAGCATTCCTGTATCTCACTGG + Intronic
1043395655 8:79833314-79833336 ACTGGATTTCTGTGACCGACGGG - Intergenic
1047261581 8:123266255-123266277 ATAGCATTCTTGTGTTAGACTGG - Intronic
1047527300 8:125644486-125644508 GTTCCATTCCTGTTTCCGGCTGG - Intergenic