ID: 968551605

View in Genome Browser
Species Human (GRCh38)
Location 4:1226317-1226339
Sequence ACGGATGGCCAGTCGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 32}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968551605_968551626 30 Left 968551605 4:1226317-1226339 CCTGTGTCCGACTGGCCATCCGT 0: 1
1: 0
2: 0
3: 2
4: 32
Right 968551626 4:1226370-1226392 CAGGACAGGGCTGCATTCATAGG No data
968551605_968551621 6 Left 968551605 4:1226317-1226339 CCTGTGTCCGACTGGCCATCCGT 0: 1
1: 0
2: 0
3: 2
4: 32
Right 968551621 4:1226346-1226368 GGGGAGGAGGAGGGGGCAGGAGG 0: 1
1: 17
2: 169
3: 1320
4: 6809
968551605_968551614 -4 Left 968551605 4:1226317-1226339 CCTGTGTCCGACTGGCCATCCGT 0: 1
1: 0
2: 0
3: 2
4: 32
Right 968551614 4:1226336-1226358 CCGTCTCCCTGGGGAGGAGGAGG No data
968551605_968551612 -7 Left 968551605 4:1226317-1226339 CCTGTGTCCGACTGGCCATCCGT 0: 1
1: 0
2: 0
3: 2
4: 32
Right 968551612 4:1226333-1226355 CATCCGTCTCCCTGGGGAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 234
968551605_968551610 -10 Left 968551605 4:1226317-1226339 CCTGTGTCCGACTGGCCATCCGT 0: 1
1: 0
2: 0
3: 2
4: 32
Right 968551610 4:1226330-1226352 GGCCATCCGTCTCCCTGGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 127
968551605_968551615 -3 Left 968551605 4:1226317-1226339 CCTGTGTCCGACTGGCCATCCGT 0: 1
1: 0
2: 0
3: 2
4: 32
Right 968551615 4:1226337-1226359 CGTCTCCCTGGGGAGGAGGAGGG No data
968551605_968551624 17 Left 968551605 4:1226317-1226339 CCTGTGTCCGACTGGCCATCCGT 0: 1
1: 0
2: 0
3: 2
4: 32
Right 968551624 4:1226357-1226379 GGGGGCAGGAGGCCAGGACAGGG 0: 1
1: 1
2: 17
3: 123
4: 1020
968551605_968551620 3 Left 968551605 4:1226317-1226339 CCTGTGTCCGACTGGCCATCCGT 0: 1
1: 0
2: 0
3: 2
4: 32
Right 968551620 4:1226343-1226365 CCTGGGGAGGAGGAGGGGGCAGG 0: 1
1: 4
2: 39
3: 368
4: 2868
968551605_968551623 16 Left 968551605 4:1226317-1226339 CCTGTGTCCGACTGGCCATCCGT 0: 1
1: 0
2: 0
3: 2
4: 32
Right 968551623 4:1226356-1226378 AGGGGGCAGGAGGCCAGGACAGG 0: 1
1: 0
2: 15
3: 127
4: 948
968551605_968551617 -1 Left 968551605 4:1226317-1226339 CCTGTGTCCGACTGGCCATCCGT 0: 1
1: 0
2: 0
3: 2
4: 32
Right 968551617 4:1226339-1226361 TCTCCCTGGGGAGGAGGAGGGGG No data
968551605_968551616 -2 Left 968551605 4:1226317-1226339 CCTGTGTCCGACTGGCCATCCGT 0: 1
1: 0
2: 0
3: 2
4: 32
Right 968551616 4:1226338-1226360 GTCTCCCTGGGGAGGAGGAGGGG 0: 1
1: 0
2: 9
3: 84
4: 1273
968551605_968551622 11 Left 968551605 4:1226317-1226339 CCTGTGTCCGACTGGCCATCCGT 0: 1
1: 0
2: 0
3: 2
4: 32
Right 968551622 4:1226351-1226373 GGAGGAGGGGGCAGGAGGCCAGG 0: 1
1: 6
2: 56
3: 388
4: 2398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968551605 Original CRISPR ACGGATGGCCAGTCGGACAC AGG (reversed) Intronic
900485675 1:2921524-2921546 CTGGATGGACAGACGGACACAGG - Intergenic
901822481 1:11838854-11838876 AAGGACGGCCAGTGGGACGCTGG - Intronic
905685206 1:39902447-39902469 ACGGGTGACCAGACGGACGCCGG - Intergenic
905857039 1:41321028-41321050 ACGGATGGGAAGGCGGACAGAGG - Intergenic
912623733 1:111191013-111191035 CCTGATGGCCAGTCAGACTCTGG - Intronic
913441025 1:118897718-118897740 ACGGATGGCCATTAAGAGACAGG - Intronic
1063416260 10:5874875-5874897 ACGGAGGGCCAGCCTGACAGAGG + Intronic
1068066246 10:52135748-52135770 ATGGATGGCCTGTAGGAGACAGG + Intronic
1075906415 10:126085645-126085667 ACGGATGGACAGACAGACAAAGG - Intronic
1084302110 11:68258675-68258697 TAGGATGGCCAGTTGGACTCAGG + Intergenic
1102456124 12:113071774-113071796 ACGGATGGGCAGGCGGGCAGCGG + Intronic
1104900965 12:132189356-132189378 ATGGACGGACAGACGGACACAGG - Intergenic
1106413824 13:29529341-29529363 ACGTATGCCCAGTTGGTCACTGG - Intronic
1121719600 14:96100211-96100233 ACGGATGACCAGTCAGTCACAGG + Intergenic
1122140512 14:99660312-99660334 ACGGTTGGCAAGTCGGTCACAGG + Exonic
1129465341 15:75721646-75721668 AAGGATGGCCAGGCGAACAGAGG + Intergenic
1132746078 16:1436861-1436883 ACAGATGGAAAGACGGACACGGG + Intronic
1135891232 16:26359288-26359310 AGTGATGGCCAGTGTGACACAGG - Intergenic
1146968172 17:37050682-37050704 ACGGCAGGCAAGTCGGACAAAGG - Intronic
1152646416 17:81470813-81470835 ATGGATGGGCAGATGGACACAGG - Intergenic
1161772263 19:6237193-6237215 ACGCATGGCCCGCCGGCCACAGG - Intronic
931718116 2:65045566-65045588 AGGGATGGCCAGTTGGACTAGGG + Intergenic
935521711 2:104114599-104114621 ACTGAGAGCCAATCGGACACAGG + Intergenic
937135164 2:119545452-119545474 AGGGAAGGCAAATCGGACACAGG + Intronic
1173949499 20:46979084-46979106 ACAGATGGCCAGTCGGCTAAGGG - Intronic
1176024025 20:62976787-62976809 AGGGATGACCAGAAGGACACAGG - Intergenic
1179958011 21:44751845-44751867 AGGGCTTGCCAGTGGGACACCGG - Intergenic
952241169 3:31532739-31532761 ACGGATGGCTAGTGGGGCGCCGG + Intronic
968551605 4:1226317-1226339 ACGGATGGCCAGTCGGACACAGG - Intronic
986199880 5:5570827-5570849 AGGCAGGGCCGGTCGGACACTGG - Intergenic
1024325632 7:48107273-48107295 ACTGATGCCCAGAAGGACACAGG - Intronic
1032971100 7:137164578-137164600 TCGGCTGGCCAGTCGGCCTCTGG - Intergenic
1049584134 8:143425186-143425208 ACAGATGGGCTGTCGGGCACGGG + Intronic
1049593235 8:143472026-143472048 AAGGCTGGCCAGCGGGACACCGG + Intronic
1059125952 9:111685217-111685239 AGGGCTGGCCAGTGGGACAGTGG - Intergenic