ID: 968551606

View in Genome Browser
Species Human (GRCh38)
Location 4:1226324-1226346
Sequence CAGGGAGACGGATGGCCAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 166}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968551606_968551616 -9 Left 968551606 4:1226324-1226346 CCGACTGGCCATCCGTCTCCCTG 0: 1
1: 0
2: 1
3: 15
4: 166
Right 968551616 4:1226338-1226360 GTCTCCCTGGGGAGGAGGAGGGG 0: 1
1: 0
2: 9
3: 84
4: 1273
968551606_968551622 4 Left 968551606 4:1226324-1226346 CCGACTGGCCATCCGTCTCCCTG 0: 1
1: 0
2: 1
3: 15
4: 166
Right 968551622 4:1226351-1226373 GGAGGAGGGGGCAGGAGGCCAGG 0: 1
1: 6
2: 56
3: 388
4: 2398
968551606_968551623 9 Left 968551606 4:1226324-1226346 CCGACTGGCCATCCGTCTCCCTG 0: 1
1: 0
2: 1
3: 15
4: 166
Right 968551623 4:1226356-1226378 AGGGGGCAGGAGGCCAGGACAGG 0: 1
1: 0
2: 15
3: 127
4: 948
968551606_968551621 -1 Left 968551606 4:1226324-1226346 CCGACTGGCCATCCGTCTCCCTG 0: 1
1: 0
2: 1
3: 15
4: 166
Right 968551621 4:1226346-1226368 GGGGAGGAGGAGGGGGCAGGAGG 0: 1
1: 17
2: 169
3: 1320
4: 6809
968551606_968551626 23 Left 968551606 4:1226324-1226346 CCGACTGGCCATCCGTCTCCCTG 0: 1
1: 0
2: 1
3: 15
4: 166
Right 968551626 4:1226370-1226392 CAGGACAGGGCTGCATTCATAGG No data
968551606_968551620 -4 Left 968551606 4:1226324-1226346 CCGACTGGCCATCCGTCTCCCTG 0: 1
1: 0
2: 1
3: 15
4: 166
Right 968551620 4:1226343-1226365 CCTGGGGAGGAGGAGGGGGCAGG 0: 1
1: 4
2: 39
3: 368
4: 2868
968551606_968551627 28 Left 968551606 4:1226324-1226346 CCGACTGGCCATCCGTCTCCCTG 0: 1
1: 0
2: 1
3: 15
4: 166
Right 968551627 4:1226375-1226397 CAGGGCTGCATTCATAGGCCCGG 0: 1
1: 0
2: 2
3: 16
4: 174
968551606_968551624 10 Left 968551606 4:1226324-1226346 CCGACTGGCCATCCGTCTCCCTG 0: 1
1: 0
2: 1
3: 15
4: 166
Right 968551624 4:1226357-1226379 GGGGGCAGGAGGCCAGGACAGGG 0: 1
1: 1
2: 17
3: 123
4: 1020
968551606_968551617 -8 Left 968551606 4:1226324-1226346 CCGACTGGCCATCCGTCTCCCTG 0: 1
1: 0
2: 1
3: 15
4: 166
Right 968551617 4:1226339-1226361 TCTCCCTGGGGAGGAGGAGGGGG No data
968551606_968551615 -10 Left 968551606 4:1226324-1226346 CCGACTGGCCATCCGTCTCCCTG 0: 1
1: 0
2: 1
3: 15
4: 166
Right 968551615 4:1226337-1226359 CGTCTCCCTGGGGAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968551606 Original CRISPR CAGGGAGACGGATGGCCAGT CGG (reversed) Intronic
900132410 1:1092652-1092674 CAGGGAGACGGAGGCCCTGGAGG + Intronic
902238708 1:15074241-15074263 CAGGGAGGCGGATGGCAGGGAGG - Intronic
905526182 1:38641781-38641803 CAGCGAGACAGATGGGGAGTCGG + Intergenic
905744572 1:40403593-40403615 CAGGAAGATGGATGGGAAGTGGG + Intronic
906086738 1:43142550-43142572 TAGGGAGATAGATGGGCAGTGGG - Intergenic
909566162 1:77055707-77055729 GAGGAAGAGGGATGCCCAGTGGG - Intronic
912511325 1:110192229-110192251 CAGGGAGAAGGAGGGACAGGAGG - Intronic
914831051 1:151171228-151171250 CAGGGAGATGAATGTGCAGTGGG + Intronic
914917124 1:151825744-151825766 CAGGGAGCCGCCTGGCCAGCAGG + Intronic
917782488 1:178413041-178413063 CAGACAGACGGATGGACAGACGG - Intronic
924729412 1:246697957-246697979 CAGGGAAACTGATGTTCAGTGGG - Intergenic
1063523406 10:6761131-6761153 CAGTGAGATGGATGGGGAGTTGG - Intergenic
1067292778 10:44956477-44956499 CAGGGAGAAGGAGAGGCAGTAGG + Intergenic
1067450952 10:46381540-46381562 CAGGGAGACAGACCTCCAGTGGG - Intronic
1067586291 10:47478211-47478233 CAGGGAGACAGACCTCCAGTGGG + Intronic
1067730788 10:48809946-48809968 CAGGGAGATGAATGGCCAATGGG - Intronic
1067732215 10:48820516-48820538 CAGGGAGACAGAGGGCCTGGGGG + Intronic
1067960763 10:50846395-50846417 CAGGGAGAAGGATGGTAATTTGG - Intronic
1075640126 10:124058628-124058650 AAGGGAGACGGGTGGCCGGTGGG - Intronic
1075962845 10:126584369-126584391 CAGGTAGATGGATGGACAGATGG - Intronic
1076581813 10:131517063-131517085 CAGGGAGACGGAAGGCAGGAAGG - Intergenic
1076821430 10:132941918-132941940 CAGGGAGAGGGAGGGCCTCTGGG - Intronic
1077025599 11:438573-438595 CCTGGAGACGGATGGACAGATGG - Intronic
1077025628 11:438669-438691 CCTGGAGACGGATGGACAGATGG - Intronic
1077485434 11:2836341-2836363 CAGACAGACGGATGGACAGATGG - Intronic
1078310347 11:10234876-10234898 AAGGGATACGGGTGGCCAGGTGG + Intronic
1080384095 11:31800210-31800232 CAGGGAGATGCAGGGCGAGTCGG - Intronic
1080846119 11:36028473-36028495 CAGGGAGTCGGTTGGCAAATGGG + Intronic
1081810919 11:45913772-45913794 CAGGGAGAGGGCTGGCAAGCGGG - Intronic
1083179046 11:60972520-60972542 CAGGGAATCAGATGGCCAGAAGG + Intronic
1084953100 11:72677440-72677462 CAGGGAGAGGGATGGGCAGCAGG - Intergenic
1087049403 11:93870084-93870106 CAGGAAGAGAGATGGCCAGAAGG - Intergenic
1087396614 11:97609134-97609156 CAGGGAGATGGATGGGGAGCTGG + Intergenic
1089497409 11:118914620-118914642 CAGGGAGACAGAAGGCCACACGG + Intronic
1093086446 12:14870671-14870693 CAGGGAGAGGGTTAGACAGTAGG - Intronic
1094739715 12:33275034-33275056 CAGGGAGAAGGAGGAGCAGTTGG - Intergenic
1097019534 12:56010017-56010039 CAGAGAGAGAGATGGCCAGTTGG - Intronic
1104641375 12:130469500-130469522 CAGGGAGATAAATGGCCATTTGG + Intronic
1105631574 13:22174840-22174862 CAGAGAGAGAGAAGGCCAGTGGG - Intergenic
1105828676 13:24144825-24144847 CAAGGAGGTGGATGGCCAGGAGG - Intronic
1110085118 13:71368504-71368526 TAGAGAGACAGATGGCCAGAGGG + Intergenic
1118419938 14:65590827-65590849 CAGGGAGATGGAGTGCCAGAAGG - Intronic
1120930743 14:89845788-89845810 CAGGGAGACGGATGTGCAGTCGG + Intronic
1122051488 14:99063948-99063970 GAGGGAGGCGGATGGACACTGGG + Intergenic
1122409443 14:101518438-101518460 CTGGGTGACGGAAGGCCAGTGGG + Intergenic
1124517195 15:30376663-30376685 CAGGGAGGAGGATGGCAAGCTGG + Intronic
1124725749 15:32154331-32154353 CAGGGAGGAGGATGGCAAGCTGG - Intronic
1125045315 15:35238217-35238239 CAGGGAGAGGGAGGGCGGGTGGG + Intronic
1125262759 15:37846623-37846645 CAGGGAGAAGAATGGTCAGGAGG - Intergenic
1128943929 15:71809053-71809075 CAGGGAGGGGGCTGGCAAGTGGG + Intronic
1129225447 15:74167990-74168012 CAAGAAGACAGGTGGCCAGTGGG - Intergenic
1131397990 15:92101953-92101975 CAGGGAGAGGGATGGCGATGGGG - Intronic
1132626596 16:894370-894392 CAGGTGGGCGGATGGCCAGGTGG - Intronic
1132977119 16:2716425-2716447 CAGGGACACTCATGGCCAGAGGG - Intronic
1133302623 16:4792093-4792115 CAGGAAGACTGAGGGCCAGAGGG + Intronic
1136064016 16:27746755-27746777 CAGGGAGCAGGAGGGCCAGCGGG + Intronic
1136296856 16:29308838-29308860 CAGGCAGAGGGATGGGCAGAGGG - Intergenic
1136591794 16:31221991-31222013 CAGCGAGAGGGCTGGCGAGTGGG + Intronic
1137589042 16:49682263-49682285 CAGGGAGACGGTTGGAGAATGGG - Intronic
1138309297 16:56009499-56009521 CAGGGAGAATGGTGGGCAGTAGG + Intergenic
1138614868 16:58157310-58157332 CAGGGAGGATGCTGGCCAGTTGG + Intergenic
1139209653 16:65064930-65064952 CAGGGAGACGGAGGCCCAACGGG + Intronic
1141518840 16:84564157-84564179 CAGGGAGTGGGGTGGGCAGTGGG + Intergenic
1142343394 16:89538402-89538424 CTGGGGGACGGATGGACAGGAGG + Intronic
1143022597 17:3924577-3924599 CAGGGACGCGGGTGGCAAGTTGG + Intronic
1143655746 17:8292619-8292641 CAGGTAGGAGGATGGCCACTGGG - Intronic
1143927194 17:10382366-10382388 CTGGGAGATGGTGGGCCAGTGGG + Intergenic
1147427447 17:40352659-40352681 CAGGGAGACGAGTGGACAGGTGG - Intronic
1149412078 17:56419146-56419168 CATGGAGAAGAAAGGCCAGTGGG - Intronic
1151293398 17:73166072-73166094 CAGCGAGTTGGATGGCCAGGAGG + Intronic
1151523032 17:74644724-74644746 CAAGGAGAGGGATGGCAAGGAGG - Intergenic
1152705026 17:81838907-81838929 CAGGGAAAGGTATGGACAGTTGG + Intergenic
1152737758 17:82005626-82005648 CAAGCAGACGGAGGGCCAGCGGG - Intronic
1158515328 18:58125936-58125958 CAGGCAGACGGATGCCCGGGTGG - Intronic
1158582083 18:58692394-58692416 GAGAGAGAGGAATGGCCAGTCGG - Intronic
1160783901 19:891027-891049 CAGGGGCACCGATGGGCAGTGGG + Exonic
1161442118 19:4297950-4297972 CGGGGAGAGGGAGGGGCAGTGGG - Intronic
1161470937 19:4456522-4456544 CAGGGAGCTGGCTGGCCAGAGGG - Intronic
1163176870 19:15570225-15570247 CAGGGAGAGGGATGGAGAGTTGG + Intergenic
1163770295 19:19186947-19186969 CAGGGCCACGGATGGCTCGTTGG + Exonic
1164386859 19:27778841-27778863 AAGGGACACGGGAGGCCAGTTGG - Intergenic
1164522620 19:28990632-28990654 CAGGGAGACTGAAAGCCAGTGGG + Intergenic
1166569246 19:43783215-43783237 CAGCGAGCCGGGCGGCCAGTGGG - Intergenic
1167245185 19:48369006-48369028 CAAGGAGACGGAAGCCCAGCTGG + Intronic
929018536 2:37526699-37526721 CAGGGAGACGGATAGCACCTTGG + Intergenic
929451671 2:42042262-42042284 CAGGTAGAGGGATGGAGAGTTGG - Intergenic
930920669 2:56749717-56749739 CATGGAGAAGGCTGGCCATTAGG - Intergenic
931269006 2:60685560-60685582 GAGGGAGACAGATGCCCAGCTGG + Intergenic
932497220 2:72151944-72151966 GAGGGAGAGGGATGACCACTAGG - Intergenic
935613091 2:105046529-105046551 CAGGAAGACAGATGTCCAGGAGG - Intronic
935655649 2:105420593-105420615 CAGAGAGAGGGATGGCGAGGAGG + Intronic
936072763 2:109382410-109382432 GAGGGAGGTGGGTGGCCAGTGGG - Intronic
936444820 2:112587140-112587162 CCAGGAGAAGGATGGCCAGGTGG - Intronic
942304891 2:174597638-174597660 CAGGCAGACAGAGGGCCAGCGGG + Intronic
944673071 2:202012241-202012263 CAGACAGACGGATGGACAGAAGG + Intergenic
945340898 2:208652645-208652667 CAGGGAGATGCATGCCCAGTGGG + Intronic
946315856 2:218911588-218911610 CAGGGAGGTGGATGGCCCATGGG - Intergenic
947769428 2:232659358-232659380 CCCGGAGAAGGATGGACAGTGGG + Intronic
1172954636 20:38747722-38747744 CAGCCAGACGGATGGCCACGTGG + Intergenic
1173220041 20:41125151-41125173 CAGGGAGCAGGAAGGCCAGAAGG + Intergenic
1174538870 20:51273920-51273942 CCTGGGGACGGATGGCAAGTGGG + Intergenic
1175341015 20:58228814-58228836 CAGGGAGACCGATGGGCGGGCGG + Intergenic
1175598639 20:60255270-60255292 CAGTGAGAGGGATGGGCAGAGGG + Intergenic
1175890538 20:62313971-62313993 CACAGAGACGGGTGGCGAGTGGG + Intronic
1178689727 21:34740954-34740976 AAGGGAGAAGGATGGAAAGTAGG - Intergenic
1183328592 22:37207462-37207484 GAGGGAGCCGAAGGGCCAGTAGG + Exonic
1183429885 22:37759127-37759149 GAGGGAGAAGGGTGGTCAGTGGG - Intronic
1183471080 22:38007127-38007149 CAGGGTGCCAGATGTCCAGTTGG - Intronic
1183680803 22:39328145-39328167 CATGGAGACCGAGAGCCAGTGGG - Intergenic
1183731316 22:39620091-39620113 CAGGTAGATGGATGGACAGGTGG - Intronic
1183994123 22:41620638-41620660 CGGGGAGACACATGGCCAGGAGG - Intronic
1184728149 22:46357989-46358011 CAGGCAGAGCGCTGGCCAGTGGG + Intergenic
1185064682 22:48625425-48625447 CAGTGAGCTGCATGGCCAGTGGG - Intronic
952241167 3:31532732-31532754 TGGGGATACGGATGGCTAGTGGG + Intronic
953277381 3:41515631-41515653 GAGAGAGACGGAGTGCCAGTAGG + Intronic
953435468 3:42874205-42874227 CAGAGGGAGGGGTGGCCAGTGGG + Exonic
953875113 3:46662274-46662296 CAGGGAGAGTGAGGGCCAGGAGG + Intergenic
961057867 3:123804263-123804285 CAGGGAGAGGGCTAGCAAGTGGG + Intronic
961721396 3:128899065-128899087 AAGGGACATGGATGGCCAGGTGG - Intronic
961772666 3:129261372-129261394 CAAGGAGAGAGAAGGCCAGTGGG + Intronic
965401477 3:168218124-168218146 CAGGGAGAGGAGTGGCCAGTGGG - Intergenic
966111081 3:176402282-176402304 CAGTGAGCTAGATGGCCAGTAGG + Intergenic
968551606 4:1226324-1226346 CAGGGAGACGGATGGCCAGTCGG - Intronic
968579922 4:1385076-1385098 CAGGAGGAGGAATGGCCAGTGGG + Intronic
968844213 4:3030924-3030946 CAGGGAGGAGGAAGGCCATTGGG + Intronic
969565180 4:7973112-7973134 TAGGGTGAGGGATGGCAAGTAGG + Intronic
976231195 4:82845085-82845107 CAGGCAGATGGATGGGGAGTGGG + Intronic
979103341 4:116651209-116651231 CAGGGACAGGGATGGACAGTTGG + Intergenic
986230960 5:5864550-5864572 CAGGGAGATGGATGGGGAGCTGG + Intergenic
986273912 5:6257107-6257129 CAGGGAGAGGGATGGCGATTGGG - Intergenic
986545983 5:8897539-8897561 GTGGGACACGGTTGGCCAGTAGG - Intergenic
990112109 5:52339403-52339425 GAGAGAGATGAATGGCCAGTTGG - Intergenic
998175761 5:139901087-139901109 GGGGGAATCGGATGGCCAGTAGG - Intronic
1000688039 5:164277537-164277559 CAGAGAGACGGATGGACGGTGGG - Intergenic
1001268550 5:170293220-170293242 CAGGGAAAGGGTAGGCCAGTTGG + Intronic
1001858356 5:175032215-175032237 CAGGGAGGGGGATGGTCAGCTGG - Intergenic
1004465241 6:15879084-15879106 CAGGGAGATGGAGGTCCAGAAGG - Intergenic
1006428706 6:33982304-33982326 CAGGAATAGGGATGGGCAGTGGG - Intergenic
1006639817 6:35484197-35484219 CAGGGAGCCAGATGGTCAGATGG - Intronic
1007388834 6:41538058-41538080 CAGGGAGACGGGGGGCTAGGTGG + Intergenic
1007811007 6:44485653-44485675 CAGGGAGACAGATGGACAGGGGG + Intergenic
1011613581 6:89177673-89177695 CAGGCAGACGGATGGCCCAATGG - Exonic
1011855708 6:91688183-91688205 TAGGGAGACTGATGGCAAATAGG + Intergenic
1014845749 6:126274804-126274826 AAGGGAAACTGATGGCCACTGGG + Intergenic
1015905550 6:138113222-138113244 CAGGGAGACACAGGGTCAGTGGG - Intergenic
1016895764 6:149050964-149050986 CAGGGAGACTGCTGGGCAGGTGG + Intronic
1017014487 6:150089069-150089091 CAGGGAGTCGACTGCCCAGTGGG + Intergenic
1018525992 6:164710505-164710527 CAGGGAGATGGATGGGGAGCCGG + Intergenic
1019156022 6:170039533-170039555 CAGGGACACGGTGGGCCAGCAGG - Intergenic
1019156047 6:170039624-170039646 CAGGGACACGGTGGGCCAGCGGG - Intergenic
1019156062 6:170039681-170039703 CAGGGACACGGAGGGACAGCAGG - Intergenic
1019156086 6:170039776-170039798 CAGGGACACGGAGGGACAGCGGG - Intergenic
1019289318 7:242574-242596 CAGGGAGCGGGATGGACAGTGGG + Intronic
1024684299 7:51728699-51728721 CAGAGAGACTGATGGGCTGTAGG - Intergenic
1026873187 7:73865548-73865570 CAGGGAGACAGATGGGCAGGTGG - Intronic
1028160315 7:87476846-87476868 CAGGTAGCAGGATGACCAGTGGG + Intronic
1030296482 7:107933870-107933892 CAGGGAGATGCATGGGCGGTGGG - Intronic
1033943230 7:146681489-146681511 CAGGGAGAAGGGTGGGGAGTGGG + Intronic
1034431811 7:151044930-151044952 CAGGGAGACGGATCCTGAGTTGG + Intronic
1034892339 7:154852373-154852395 CAGGGAGACAGATGCACTGTGGG - Intronic
1035412746 7:158658197-158658219 CAGGGAGAGGGAAGGGCAGAAGG + Intronic
1036751575 8:11446884-11446906 CAGGGAGAAGGAAGCCCTGTAGG - Intronic
1038006708 8:23436618-23436640 CAGGGAGGGGGAAGGCTAGTAGG + Intronic
1039398536 8:37247787-37247809 TCGGGAGACAGATGGCCAGGCGG + Intergenic
1049206207 8:141364806-141364828 CTGGGAGGGGCATGGCCAGTTGG + Intronic
1049362934 8:142220853-142220875 CAGGGAAACTGCTGGCCAGGAGG - Intronic
1049389382 8:142360237-142360259 CAGGCAGAGGCATGGCCAGGAGG + Intronic
1051172509 9:14332792-14332814 GAGAGAGACGGATGGGGAGTGGG + Intronic
1054707651 9:68479431-68479453 CCGAGAGAAGGATGGCCTGTGGG + Exonic
1056229548 9:84528225-84528247 GAGGGAGACGGAGAGCCAGAGGG + Intergenic
1057942765 9:99299232-99299254 CAGGGAAAGGGAGGGCCAGGTGG + Intergenic
1058636884 9:107046254-107046276 CAGAGGGAAGGATGGACAGTGGG - Intergenic
1061478348 9:130884153-130884175 CCGGGAGATGGACGGCCAGCCGG + Exonic
1062422266 9:136488502-136488524 CAGGGAGACGGCTGCTCAGAGGG - Intergenic
1185613167 X:1404019-1404041 CAGGTAGACGGATGGATAGATGG + Intronic
1186183312 X:6993867-6993889 CATGGAGTGGGATGTCCAGTAGG + Intergenic
1187908810 X:24091534-24091556 GAGGGCGAGGGGTGGCCAGTGGG + Intergenic
1190581585 X:51896283-51896305 CAGGGTGACCAATGGCTAGTGGG + Intronic
1190917880 X:54823723-54823745 CAGGGACTCAGATGGCCTGTGGG - Intergenic
1192491583 X:71580167-71580189 TAGGGAGGTGGAGGGCCAGTGGG + Intronic
1197087053 X:122491107-122491129 CAGGGAGAAGGGTGGGAAGTGGG - Intergenic
1200117462 X:153775623-153775645 CAGGCAGATGGACAGCCAGTTGG - Exonic
1200875855 Y:8154097-8154119 CAGGAAGGCAGATGGCCAGGGGG + Intergenic