ID: 968551607

View in Genome Browser
Species Human (GRCh38)
Location 4:1226325-1226347
Sequence CGACTGGCCATCCGTCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 55}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968551598_968551607 10 Left 968551598 4:1226292-1226314 CCCACCCCATCCGGATGATTGCA 0: 1
1: 0
2: 0
3: 5
4: 84
Right 968551607 4:1226325-1226347 CGACTGGCCATCCGTCTCCCTGG 0: 1
1: 0
2: 0
3: 2
4: 55
968551594_968551607 26 Left 968551594 4:1226276-1226298 CCCCTGCACGGCACTTCCCACCC 0: 1
1: 1
2: 2
3: 23
4: 305
Right 968551607 4:1226325-1226347 CGACTGGCCATCCGTCTCCCTGG 0: 1
1: 0
2: 0
3: 2
4: 55
968551596_968551607 24 Left 968551596 4:1226278-1226300 CCTGCACGGCACTTCCCACCCCA 0: 1
1: 0
2: 3
3: 17
4: 308
Right 968551607 4:1226325-1226347 CGACTGGCCATCCGTCTCCCTGG 0: 1
1: 0
2: 0
3: 2
4: 55
968551602_968551607 4 Left 968551602 4:1226298-1226320 CCATCCGGATGATTGCATTCCTG 0: 1
1: 0
2: 0
3: 4
4: 105
Right 968551607 4:1226325-1226347 CGACTGGCCATCCGTCTCCCTGG 0: 1
1: 0
2: 0
3: 2
4: 55
968551595_968551607 25 Left 968551595 4:1226277-1226299 CCCTGCACGGCACTTCCCACCCC 0: 1
1: 1
2: 2
3: 23
4: 311
Right 968551607 4:1226325-1226347 CGACTGGCCATCCGTCTCCCTGG 0: 1
1: 0
2: 0
3: 2
4: 55
968551600_968551607 6 Left 968551600 4:1226296-1226318 CCCCATCCGGATGATTGCATTCC 0: 1
1: 0
2: 4
3: 46
4: 187
Right 968551607 4:1226325-1226347 CGACTGGCCATCCGTCTCCCTGG 0: 1
1: 0
2: 0
3: 2
4: 55
968551603_968551607 0 Left 968551603 4:1226302-1226324 CCGGATGATTGCATTCCTGTGTC No data
Right 968551607 4:1226325-1226347 CGACTGGCCATCCGTCTCCCTGG 0: 1
1: 0
2: 0
3: 2
4: 55
968551601_968551607 5 Left 968551601 4:1226297-1226319 CCCATCCGGATGATTGCATTCCT 0: 1
1: 0
2: 0
3: 5
4: 284
Right 968551607 4:1226325-1226347 CGACTGGCCATCCGTCTCCCTGG 0: 1
1: 0
2: 0
3: 2
4: 55
968551593_968551607 29 Left 968551593 4:1226273-1226295 CCGCCCCTGCACGGCACTTCCCA 0: 1
1: 0
2: 3
3: 25
4: 303
Right 968551607 4:1226325-1226347 CGACTGGCCATCCGTCTCCCTGG 0: 1
1: 0
2: 0
3: 2
4: 55
968551599_968551607 9 Left 968551599 4:1226293-1226315 CCACCCCATCCGGATGATTGCAT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 968551607 4:1226325-1226347 CGACTGGCCATCCGTCTCCCTGG 0: 1
1: 0
2: 0
3: 2
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968551607 Original CRISPR CGACTGGCCATCCGTCTCCC TGG Intronic