ID: 968551608

View in Genome Browser
Species Human (GRCh38)
Location 4:1226326-1226348
Sequence GACTGGCCATCCGTCTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 91}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968551593_968551608 30 Left 968551593 4:1226273-1226295 CCGCCCCTGCACGGCACTTCCCA 0: 1
1: 0
2: 3
3: 25
4: 303
Right 968551608 4:1226326-1226348 GACTGGCCATCCGTCTCCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 91
968551601_968551608 6 Left 968551601 4:1226297-1226319 CCCATCCGGATGATTGCATTCCT 0: 1
1: 0
2: 0
3: 5
4: 284
Right 968551608 4:1226326-1226348 GACTGGCCATCCGTCTCCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 91
968551596_968551608 25 Left 968551596 4:1226278-1226300 CCTGCACGGCACTTCCCACCCCA 0: 1
1: 0
2: 3
3: 17
4: 308
Right 968551608 4:1226326-1226348 GACTGGCCATCCGTCTCCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 91
968551600_968551608 7 Left 968551600 4:1226296-1226318 CCCCATCCGGATGATTGCATTCC 0: 1
1: 0
2: 4
3: 46
4: 187
Right 968551608 4:1226326-1226348 GACTGGCCATCCGTCTCCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 91
968551598_968551608 11 Left 968551598 4:1226292-1226314 CCCACCCCATCCGGATGATTGCA 0: 1
1: 0
2: 0
3: 5
4: 84
Right 968551608 4:1226326-1226348 GACTGGCCATCCGTCTCCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 91
968551602_968551608 5 Left 968551602 4:1226298-1226320 CCATCCGGATGATTGCATTCCTG 0: 1
1: 0
2: 0
3: 4
4: 105
Right 968551608 4:1226326-1226348 GACTGGCCATCCGTCTCCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 91
968551594_968551608 27 Left 968551594 4:1226276-1226298 CCCCTGCACGGCACTTCCCACCC 0: 1
1: 1
2: 2
3: 23
4: 305
Right 968551608 4:1226326-1226348 GACTGGCCATCCGTCTCCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 91
968551603_968551608 1 Left 968551603 4:1226302-1226324 CCGGATGATTGCATTCCTGTGTC 0: 1
1: 0
2: 2
3: 9
4: 144
Right 968551608 4:1226326-1226348 GACTGGCCATCCGTCTCCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 91
968551599_968551608 10 Left 968551599 4:1226293-1226315 CCACCCCATCCGGATGATTGCAT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 968551608 4:1226326-1226348 GACTGGCCATCCGTCTCCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 91
968551595_968551608 26 Left 968551595 4:1226277-1226299 CCCTGCACGGCACTTCCCACCCC 0: 1
1: 1
2: 2
3: 23
4: 311
Right 968551608 4:1226326-1226348 GACTGGCCATCCGTCTCCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968551608 Original CRISPR GACTGGCCATCCGTCTCCCT GGG Intronic
901872018 1:12143695-12143717 GGCTGGCCAGCTGACTCCCTAGG + Exonic
902410834 1:16210613-16210635 GTTTGTCCATCTGTCTCCCTGGG - Intronic
902646769 1:17805007-17805029 CAGTGGCTCTCCGTCTCCCTAGG + Intronic
907954191 1:59212967-59212989 AACTGGCCATTTGTCTCCCCAGG + Intergenic
908873199 1:68638380-68638402 TACTGGCCATCTGTCTCCTTAGG + Intergenic
909647381 1:77932929-77932951 GACAGGTGATCCGTCTGCCTTGG - Intronic
912954131 1:114141015-114141037 GGCTGGCCATTCCTCTCCTTAGG + Intronic
921283533 1:213589279-213589301 GACTGACCAACCTTCTTCCTAGG - Intergenic
921312474 1:213857875-213857897 GACAGGCCATCAGTCTCCCAAGG + Intergenic
921755740 1:218854152-218854174 CACTGTCCATCCCTCTCCCATGG + Intergenic
921755985 1:218856156-218856178 CACTGTCCATCCTTCTCCCATGG + Intergenic
923124317 1:231022199-231022221 GATTGTCCATCCGTCTCTCCTGG - Intronic
1063769968 10:9185206-9185228 GACTGCCCATCTGTGTCTCTTGG - Intergenic
1063936918 10:11087859-11087881 GACCGGCCCTCCTTCTCCTTTGG - Intronic
1070360061 10:75679542-75679564 GGCTGGCCATGCATCTCTCTTGG + Intronic
1072545183 10:96431893-96431915 AACTTGCCTTCTGTCTCCCTTGG - Intronic
1083750593 11:64758708-64758730 CCCTGCCCATCCGTCTCTCTGGG - Intronic
1084638954 11:70413010-70413032 GACTGCCCATCCGTGTCCTCCGG - Intronic
1088167579 11:106956911-106956933 CTGTGGCCATCCCTCTCCCTAGG + Intronic
1090062056 11:123472727-123472749 GAGTGGCCAGCCTTCCCCCTGGG - Intergenic
1091306406 11:134539019-134539041 GACTGCCCGTCCGTCGCCCCGGG - Intergenic
1098658868 12:73068228-73068250 GACAGCCCACCCCTCTCCCTGGG + Intergenic
1098764493 12:74469119-74469141 GACTGGCCGCCCCTCTCCCCAGG + Intergenic
1099761086 12:86921080-86921102 GACTGGTGATCTGTCTTCCTCGG - Intergenic
1102422710 12:112816603-112816625 GATTGGCCCTCCCTTTCCCTGGG - Intronic
1103623532 12:122203265-122203287 GCCAGCCCATCCGTCTCCCGGGG + Intronic
1104359765 12:128121590-128121612 CACTGGCCAGCCTTCTCCCAAGG - Intergenic
1105869462 13:24491350-24491372 GACTGGTGATCCATCTGCCTTGG + Intronic
1108777328 13:53782894-53782916 GAGTTGCCAGCTGTCTCCCTTGG - Intergenic
1121488613 14:94341755-94341777 GACTGGCCATGCTCCTCGCTAGG - Intergenic
1124102757 15:26711370-26711392 AACTGGCCCTCCGACCCCCTTGG + Intronic
1129732967 15:77942295-77942317 GCCGGGTCACCCGTCTCCCTGGG + Intergenic
1132076640 15:98826938-98826960 GTCTGGCCATACGGCTGCCTAGG + Intronic
1132301683 15:100779984-100780006 GATTGGCCATCCCTGTCCGTGGG - Intergenic
1139576451 16:67845438-67845460 GACTGGACCTCTGTCTTCCTAGG + Intronic
1143173403 17:4943158-4943180 GACTGGTCATCCTTTTCCCAGGG + Exonic
1146566661 17:33919076-33919098 GACTGGCTATCTAGCTCCCTGGG + Intronic
1147592891 17:41696395-41696417 GACTGTCCTTCCCTCTCCCTTGG + Intergenic
1148431649 17:47648654-47648676 GACTCGTCATCCGCCCCCCTCGG + Intergenic
1148826172 17:50396057-50396079 GGCTGGCCATCTATCTTCCTGGG + Intronic
1152026441 17:77812444-77812466 AGCTTGCCATCTGTCTCCCTGGG - Intergenic
1152151817 17:78606041-78606063 GACTGCCCATCAGTCCTCCTGGG + Intergenic
1155175777 18:23299826-23299848 TACTAGGCATCAGTCTCCCTCGG - Intronic
1155652748 18:28160738-28160760 GACTTTCCCTTCGTCTCCCTTGG - Intronic
1156831176 18:41493229-41493251 GACTGGACTTCCCTCTGCCTTGG - Intergenic
1164386860 19:27778843-27778865 AACTGGCCTCCCGTGTCCCTTGG + Intergenic
927991789 2:27453343-27453365 TTCTGGCCCTCCTTCTCCCTAGG - Intronic
930305143 2:49667134-49667156 GGCAGTCCATCCCTCTCCCTGGG + Intergenic
930612156 2:53555088-53555110 GACTGACCTGCAGTCTCCCTTGG + Intronic
932580159 2:72988176-72988198 GAAGGGTCATCTGTCTCCCTGGG + Intronic
935139995 2:100344561-100344583 GTCTGGGCATCAGTTTCCCTAGG + Intergenic
937432689 2:121852713-121852735 GTTTGGCCATCAGTCTTCCTGGG + Intergenic
940089912 2:149903542-149903564 CACTGGTCATCTGTCTCCTTGGG - Intergenic
942277984 2:174336455-174336477 GACTGGCCACCCGCCTCCTGCGG - Exonic
947906180 2:233764958-233764980 CACTGACCATCCTTCTCCCAAGG - Intronic
948793405 2:240390588-240390610 GGCTGGTCATCCTTGTCCCTGGG - Intergenic
1170568162 20:17618196-17618218 GCCTGGCCACCCATCGCCCTGGG - Intronic
1172501951 20:35433883-35433905 CACTGGCCCTCTGTCTTCCTGGG - Exonic
1179605456 21:42513166-42513188 GACTGGCCAGGCCCCTCCCTGGG + Intronic
1180958747 22:19752837-19752859 GACTGGCCAGCCTGCTTCCTTGG - Intergenic
1185142716 22:49112298-49112320 GACTCGCCATCCTCCTCCCGTGG - Intergenic
1185341383 22:50292853-50292875 CACTGGCCTTCCTGCTCCCTGGG + Intronic
951840502 3:27028607-27028629 TACAGGCCATCTGTATCCCTTGG - Intergenic
953810603 3:46109330-46109352 TCCTGGCCATCCCCCTCCCTGGG + Intergenic
956491242 3:69774428-69774450 GACTAGCCATCCTGCTACCTGGG - Intronic
957873476 3:86115540-86115562 GACAGGCAATCCTACTCCCTTGG - Intergenic
961721397 3:128899067-128899089 ACCTGGCCATCCATGTCCCTTGG + Intronic
962759356 3:138494698-138494720 TACTTGCAATCTGTCTCCCTGGG + Exonic
968551608 4:1226326-1226348 GACTGGCCATCCGTCTCCCTGGG + Intronic
968772079 4:2513835-2513857 GTCTGTCCATCCGTCTCTCCTGG - Exonic
969420943 4:7095523-7095545 GACTGCCCCTCCGTGTGCCTGGG - Intergenic
973013319 4:45105060-45105082 GACTGACAATCCTTCTCCTTAGG - Intergenic
980184688 4:129446590-129446612 GACTGGCCACCCCTCTCACTAGG - Intergenic
986545984 5:8897541-8897563 TACTGGCCAACCGTGTCCCACGG + Intergenic
992209415 5:74463189-74463211 GACTGACCAGCAGTCTCCCCAGG + Intergenic
997775081 5:136596949-136596971 AAGTGGCCCTCCTTCTCCCTTGG - Intergenic
999101950 5:149032856-149032878 GACTGGGCCCCCATCTCCCTGGG + Intronic
1003241613 6:4350233-4350255 GACTTGCCATCTGTCTGCCTAGG + Intergenic
1007755648 6:44097525-44097547 CACTGGCTCTCCATCTCCCTTGG - Intergenic
1016562434 6:145411984-145412006 ACCTGGTGATCCGTCTCCCTCGG - Intergenic
1017491002 6:154945143-154945165 GAATGGGTCTCCGTCTCCCTCGG + Intronic
1019712265 7:2523188-2523210 GGCTGGCCCTCCGCCTCCCACGG + Intronic
1019716070 7:2539916-2539938 GCCTGCCCCTCCGTCTCCCGTGG - Intronic
1019725624 7:2600935-2600957 GACTGGTCATCAGTCACCCTTGG - Intronic
1020265097 7:6555244-6555266 GACTGGAGATCCGTCTCCAGTGG + Intergenic
1023070532 7:36427585-36427607 CTCTGGCCATCTGTCTGCCTTGG + Intronic
1026873563 7:73867430-73867452 GAAGAGCCATCTGTCTCCCTGGG + Intergenic
1027378043 7:77573992-77574014 GTCAGGTCATCCGCCTCCCTTGG + Intronic
1028779489 7:94719721-94719743 CATTGGCCACCCCTCTCCCTAGG + Intergenic
1029118611 7:98251789-98251811 GCCTGCCTATCCCTCTCCCTGGG - Intronic
1034419244 7:150980261-150980283 GCCTGGCTCTCCCTCTCCCTTGG - Intergenic
1035610562 8:960466-960488 CACAGGCAATCCGTCTGCCTTGG + Intergenic
1036012290 8:4739971-4739993 GACTGGCCAGCCGCCTGCCCAGG + Intronic
1042639678 8:70919701-70919723 GACTGGCTATCTTCCTCCCTGGG + Intergenic
1044113323 8:88303327-88303349 TGGTGGCCATCCCTCTCCCTGGG - Intronic
1057255743 9:93545563-93545585 GACTGACCATCCCTCCCACTGGG + Intronic
1062444067 9:136586025-136586047 GACTGGGCATCCGCCACCCTGGG - Intergenic
1188423415 X:30016328-30016350 GACTGGCCATCAGAATCCCTTGG - Intergenic
1189629282 X:42934425-42934447 CACTGCCCATCTCTCTCCCTGGG - Intergenic
1191877301 X:65809679-65809701 GGCTGCCCATCCCTCCCCCTGGG - Intergenic