ID: 968551609

View in Genome Browser
Species Human (GRCh38)
Location 4:1226327-1226349
Sequence ACTGGCCATCCGTCTCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 138}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968551601_968551609 7 Left 968551601 4:1226297-1226319 CCCATCCGGATGATTGCATTCCT 0: 1
1: 0
2: 0
3: 5
4: 284
Right 968551609 4:1226327-1226349 ACTGGCCATCCGTCTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 138
968551600_968551609 8 Left 968551600 4:1226296-1226318 CCCCATCCGGATGATTGCATTCC 0: 1
1: 0
2: 4
3: 46
4: 187
Right 968551609 4:1226327-1226349 ACTGGCCATCCGTCTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 138
968551598_968551609 12 Left 968551598 4:1226292-1226314 CCCACCCCATCCGGATGATTGCA 0: 1
1: 0
2: 0
3: 5
4: 84
Right 968551609 4:1226327-1226349 ACTGGCCATCCGTCTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 138
968551596_968551609 26 Left 968551596 4:1226278-1226300 CCTGCACGGCACTTCCCACCCCA 0: 1
1: 0
2: 3
3: 17
4: 308
Right 968551609 4:1226327-1226349 ACTGGCCATCCGTCTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 138
968551595_968551609 27 Left 968551595 4:1226277-1226299 CCCTGCACGGCACTTCCCACCCC 0: 1
1: 1
2: 2
3: 23
4: 311
Right 968551609 4:1226327-1226349 ACTGGCCATCCGTCTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 138
968551602_968551609 6 Left 968551602 4:1226298-1226320 CCATCCGGATGATTGCATTCCTG 0: 1
1: 0
2: 0
3: 4
4: 105
Right 968551609 4:1226327-1226349 ACTGGCCATCCGTCTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 138
968551603_968551609 2 Left 968551603 4:1226302-1226324 CCGGATGATTGCATTCCTGTGTC 0: 1
1: 0
2: 2
3: 9
4: 144
Right 968551609 4:1226327-1226349 ACTGGCCATCCGTCTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 138
968551599_968551609 11 Left 968551599 4:1226293-1226315 CCACCCCATCCGGATGATTGCAT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 968551609 4:1226327-1226349 ACTGGCCATCCGTCTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 138
968551594_968551609 28 Left 968551594 4:1226276-1226298 CCCCTGCACGGCACTTCCCACCC 0: 1
1: 1
2: 2
3: 23
4: 305
Right 968551609 4:1226327-1226349 ACTGGCCATCCGTCTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968551609 Original CRISPR ACTGGCCATCCGTCTCCCTG GGG Intronic
902258261 1:15204916-15204938 TCTGGCCATCGGTGTCTCTGGGG - Intronic
902646770 1:17805008-17805030 AGTGGCTCTCCGTCTCCCTAGGG + Intronic
903774805 1:25786012-25786034 ATTGGCCATCCCACTCTCTGGGG + Exonic
907596685 1:55726834-55726856 ACTGGCCATTCCTCTCTTTGTGG + Intergenic
908873200 1:68638381-68638403 ACTGGCCATCTGTCTCCTTAGGG + Intergenic
912567293 1:110597216-110597238 CCTCAGCATCCGTCTCCCTGGGG + Intronic
913280642 1:117181882-117181904 TCAGGCCATCCATCTGCCTGAGG - Intronic
921312475 1:213857876-213857898 ACAGGCCATCAGTCTCCCAAGGG + Intergenic
922532694 1:226356506-226356528 ACTGGCCTTCCCTCTCAGTGTGG - Intergenic
923377604 1:233380051-233380073 ACTGGCCTCTCGCCTCCCTGCGG + Intronic
1064320271 10:14298413-14298435 ACTGGCCCTCAGTCTCTGTGTGG + Intronic
1067184497 10:44015258-44015280 TCTGGCCCACAGTCTCCCTGGGG + Intergenic
1067812123 10:49438138-49438160 CCTGGCCATCGCTGTCCCTGGGG - Intergenic
1070952558 10:80442898-80442920 ACTGGCCTTCTCTCCCCCTGAGG - Intergenic
1075517754 10:123122424-123122446 CCTGTCCATCTGTCTCCCAGGGG + Intergenic
1076188680 10:128467989-128468011 ACTGGCCCTGCTCCTCCCTGAGG - Intergenic
1077485435 11:2836344-2836366 TCTGTCCATCCGTCTGTCTGTGG + Intronic
1078317046 11:10303009-10303031 ACTGGCTATCAGTCGCTCTGAGG - Intergenic
1084214838 11:67641605-67641627 CCTGCCCATCCATTTCCCTGCGG - Intergenic
1084981981 11:72834269-72834291 ACTGCCCAGCCCTCTCCCAGTGG - Intronic
1088167580 11:106956912-106956934 TGTGGCCATCCCTCTCCCTAGGG + Intronic
1091306405 11:134539018-134539040 ACTGCCCGTCCGTCGCCCCGGGG - Intergenic
1096242015 12:49964662-49964684 TCTGTTCATCCGTCTCTCTGAGG + Intronic
1098409727 12:70168565-70168587 GCTGGCCTTCTGTCTCCATGTGG + Intergenic
1102422709 12:112816602-112816624 ATTGGCCCTCCCTTTCCCTGGGG - Intronic
1103862100 12:124023822-124023844 TCTGGCCATTCCTGTCCCTGAGG + Intronic
1104450818 12:128866992-128867014 ACTGTCTCCCCGTCTCCCTGGGG + Intronic
1106654554 13:31728693-31728715 CCTGGCCATCCGCCTGCCTCAGG + Intergenic
1113841026 13:113361659-113361681 ACTGTCCTTCCGTCCCCCTCAGG - Intronic
1114062099 14:19027105-19027127 CCTCGCCATGGGTCTCCCTGCGG - Intergenic
1114635077 14:24182723-24182745 ACTGTCCACCCCTGTCCCTGTGG + Intronic
1116823494 14:49648599-49648621 ACTGGCCAAATGTCCCCCTGAGG - Intronic
1117767155 14:59095214-59095236 AGTGGCCAACCGTCTGCCTCTGG + Intergenic
1120958365 14:90102697-90102719 ACTGACTTTCTGTCTCCCTGTGG + Intronic
1121326688 14:93024295-93024317 CCTGGGCATCCTTCTGCCTGGGG - Intronic
1121884779 14:97533266-97533288 ACAGGCCCTCCTTTTCCCTGTGG + Intergenic
1122409441 14:101518435-101518457 ACTGGCCTTCCGTCACCCAGAGG - Intergenic
1123494713 15:20814362-20814384 CCTTGCCATGCGTCTCCCTGCGG + Intergenic
1123551208 15:21383455-21383477 CCTTGCCATGCGTCTCCCTGCGG + Intergenic
1124221882 15:27856436-27856458 ACTCCCCATCTCTCTCCCTGTGG + Intronic
1124517194 15:30376660-30376682 GCTTGCCATCCTCCTCCCTGCGG - Intronic
1124725750 15:32154334-32154356 GCTTGCCATCCTCCTCCCTGCGG + Intronic
1126008310 15:44279414-44279436 TCTGGCCATCCTTCTGCCTCAGG + Intergenic
1126357910 15:47815627-47815649 ACTGGCCAGGAGTCTCACTGAGG - Intergenic
1130437228 15:83913290-83913312 GCTAGACATCCCTCTCCCTGAGG + Exonic
1202959550 15_KI270727v1_random:110698-110720 CCTTGCCATGCGTCTCCCTGCGG + Intergenic
1136060436 16:27722727-27722749 AGTGGCCTTCCTTTTCCCTGAGG - Intronic
1137714789 16:50592098-50592120 ACAGGCCTGGCGTCTCCCTGTGG - Intronic
1138309294 16:56009496-56009518 ACTGCCCACCATTCTCCCTGGGG - Intergenic
1141898165 16:86971878-86971900 TCTGGCCATACATCTCCCTGAGG + Intergenic
1143017191 17:3897232-3897254 CCTGGCCTTCGGTTTCCCTGGGG - Exonic
1143362266 17:6381895-6381917 CCTGGCCTGCCCTCTCCCTGAGG - Intergenic
1148716796 17:49721730-49721752 CCTGGCCCTCCCTCTCCCTCAGG - Intronic
1148826173 17:50396058-50396080 GCTGGCCATCTATCTTCCTGGGG + Intronic
1148851522 17:50557851-50557873 ACAGCCCATCTGGCTCCCTGCGG - Intergenic
1149431167 17:56596291-56596313 ACTGGCCTCCCCTCTCCCCGGGG + Intergenic
1151397367 17:73832546-73832568 ACTGGCCATTTGTCTTGCTGTGG + Intergenic
1153742014 18:8138922-8138944 CCTGGACATCCGCCTCCATGTGG + Intronic
1160317939 18:77865765-77865787 CCTGGCTCTCCATCTCCCTGGGG + Intergenic
1160755916 19:757166-757188 ACTGGCCAGCCGTCCCCACGGGG + Exonic
1160932416 19:1577019-1577041 TCTGCCCATCAGTCCCCCTGGGG + Exonic
1163091750 19:15024819-15024841 ACAGGCCCCCAGTCTCCCTGGGG + Intergenic
1163400156 19:17087237-17087259 TCTGGCCACCCGCCTCCCCGTGG - Intronic
1165341656 19:35216726-35216748 ACTGCCCATCCAGCCCCCTGAGG + Intergenic
926332760 2:11838653-11838675 ACTGGCCCTCCCTGTTCCTGTGG - Intergenic
928134758 2:28679887-28679909 TCTAGCCATGCCTCTCCCTGTGG - Intergenic
928387876 2:30885025-30885047 CCAGGCCCTCCATCTCCCTGGGG - Intergenic
932418192 2:71586334-71586356 AATCCCCATCTGTCTCCCTGAGG + Intronic
932497221 2:72151947-72151969 AGTGGTCATCCCTCTCCCTCCGG + Intergenic
932702291 2:74000198-74000220 TCTGGTCAGCCTTCTCCCTGAGG - Intronic
932774421 2:74518992-74519014 ACTGCCTATTCCTCTCCCTGGGG - Intronic
935148202 2:100410563-100410585 CCTGCCCAACCCTCTCCCTGAGG + Intronic
936695921 2:114948635-114948657 ACTGACCATCCTTCTTCCTCAGG + Intronic
937202130 2:120210460-120210482 ACTGTCCACCCGTTTCCCCGTGG + Intergenic
938074282 2:128323460-128323482 ACTGGCCACCCCTCTGTCTGTGG + Intergenic
938140326 2:128789919-128789941 CCTGGGCACCCGTCTCCCGGGGG - Intergenic
938479469 2:131647286-131647308 CCTTGCCATGGGTCTCCCTGCGG - Intergenic
948793404 2:240390587-240390609 GCTGGTCATCCTTGTCCCTGGGG - Intergenic
1168788136 20:557311-557333 ACTGGGCCTCAGTTTCCCTGTGG - Intergenic
1170568160 20:17618195-17618217 CCTGGCCACCCATCGCCCTGGGG - Intronic
1172064788 20:32211595-32211617 ATTGCCCATCCATCTCCCTCTGG + Intronic
1173954240 20:47018397-47018419 ACTGTCCATCTTTCTCCATGAGG - Intronic
1174215216 20:48911299-48911321 AAGGGCCCTCCTTCTCCCTGTGG + Intergenic
1175824094 20:61927351-61927373 AGGGGCCATCCCTGTCCCTGGGG - Intronic
1175866910 20:62183546-62183568 TCTGGAAATGCGTCTCCCTGAGG - Intronic
1176913920 21:14602315-14602337 GCTGACCATCTGTGTCCCTGAGG + Intronic
1178451348 21:32704485-32704507 ACAGGCCATCCTTCTCCTAGTGG - Intronic
1179605457 21:42513167-42513189 ACTGGCCAGGCCCCTCCCTGGGG + Intronic
1180011335 21:45053551-45053573 ACTGGCCAGCGGGCACCCTGGGG + Intergenic
1180480589 22:15749719-15749741 CCTCGCCATGGGTCTCCCTGCGG - Intergenic
1181028199 22:20137666-20137688 ACAGGCCCTGCCTCTCCCTGGGG + Intronic
1181441223 22:22936038-22936060 CCTGGCCACCCCCCTCCCTGGGG - Intergenic
1184130967 22:42516140-42516162 ACTTGGCTTCCCTCTCCCTGCGG - Intronic
1185379990 22:50503850-50503872 TCTTCCCATCCGTGTCCCTGGGG - Exonic
950481492 3:13247046-13247068 ACTGTCCAGCTGTCTCGCTGTGG + Intergenic
953031161 3:39180810-39180832 CCTGGCCAGCCCTCTCGCTGAGG - Intergenic
955768316 3:62367710-62367732 ACCGGCCTGCAGTCTCCCTGGGG + Intergenic
956491241 3:69774427-69774449 ACTAGCCATCCTGCTACCTGGGG - Intronic
961410224 3:126715075-126715097 TCTGCCCGTCCATCTCCCTGGGG + Intronic
961721399 3:128899068-128899090 CCTGGCCATCCATGTCCCTTGGG + Intronic
968551609 4:1226327-1226349 ACTGGCCATCCGTCTCCCTGGGG + Intronic
969219981 4:5753087-5753109 ACTGGCCTTCTGGGTCCCTGGGG + Intronic
976044778 4:80931950-80931972 CCTTGCCTTCCCTCTCCCTGTGG + Intronic
980184687 4:129446589-129446611 ACTGGCCACCCCTCTCACTAGGG - Intergenic
985802382 5:2013198-2013220 TCTGAACATCCGTCTGCCTGTGG - Intergenic
988130036 5:27092117-27092139 CCTAGCCAGCCCTCTCCCTGGGG + Intronic
988934258 5:36066741-36066763 AGTGGGCTTCCTTCTCCCTGGGG - Exonic
991612059 5:68459708-68459730 ACTGGCAATGAGGCTCCCTGAGG - Intergenic
996928855 5:128861622-128861644 ACTGTCCCTCCTTGTCCCTGTGG - Intronic
1001268547 5:170293217-170293239 ACTGGCCTACCCTTTCCCTGGGG - Intronic
1007148572 6:39663478-39663500 ACTGGCCATGCTTCTGCCTTTGG - Intronic
1007256600 6:40534078-40534100 ACTGACCAGCTGTGTCCCTGTGG - Intronic
1007388832 6:41538055-41538077 CCTAGCCCCCCGTCTCCCTGTGG - Intergenic
1007755647 6:44097524-44097546 ACTGGCTCTCCATCTCCCTTGGG - Intergenic
1008954427 6:57199318-57199340 ACTGGGGCTCAGTCTCCCTGAGG - Intronic
1013348640 6:109286555-109286577 CCTGGCCCTACTTCTCCCTGGGG + Intergenic
1017905961 6:158757698-158757720 GCTGGCCATGCCTTTCCCTGGGG + Intronic
1018845053 6:167550185-167550207 AAAGACCATCCATCTCCCTGTGG - Intergenic
1019725623 7:2600934-2600956 ACTGGTCATCAGTCACCCTTGGG - Intronic
1023876909 7:44291333-44291355 GATGGCCACCCGCCTCCCTGTGG - Intronic
1023927906 7:44683550-44683572 ACAGGCCATCTGTATGCCTGTGG - Intronic
1026873564 7:73867431-73867453 AAGAGCCATCTGTCTCCCTGGGG + Intergenic
1028779490 7:94719722-94719744 ATTGGCCACCCCTCTCCCTAGGG + Intergenic
1030029263 7:105353905-105353927 ATTGGCTCTCAGTCTCCCTGGGG - Intronic
1034410080 7:150936230-150936252 AGTGTCCCTCCGTCTCCCTCTGG + Intergenic
1035412745 7:158658194-158658216 TCTGCCCTTCCCTCTCCCTGTGG - Intronic
1040614153 8:49018179-49018201 TGTGGCCATCCCTCTCCCTAAGG + Intergenic
1041004338 8:53484462-53484484 AATGGCCTTCTGCCTCCCTGAGG - Intergenic
1048035999 8:130677702-130677724 TCTTCCCATCCCTCTCCCTGGGG + Intergenic
1050527682 9:6560230-6560252 AATGCCCATCCATCTCTCTGTGG - Intronic
1053229333 9:36393258-36393280 ACTGGCCAACCTGGTCCCTGTGG + Intronic
1053375559 9:37603123-37603145 ACTGGAGATTCATCTCCCTGTGG - Intronic
1054707648 9:68479428-68479450 ACAGGCCATCCTTCTCTCGGAGG - Exonic
1056754381 9:89372872-89372894 ACAGGCCAGCCTTGTCCCTGGGG - Intronic
1057700637 9:97360997-97361019 ACTAGGCATCCATCTCCCTCTGG + Intronic
1058869949 9:109192907-109192929 CCTGGCCATCTCTCTCCTTGGGG - Intronic
1061988208 9:134142778-134142800 TGTGGCCAGCTGTCTCCCTGAGG + Intronic
1062284146 9:135765647-135765669 CCTGGACATCCATCTCCGTGGGG - Exonic
1062444066 9:136586024-136586046 ACTGGGCATCCGCCACCCTGGGG - Intergenic
1062454017 9:136627276-136627298 ACTGGGCCTGCCTCTCCCTGGGG - Intergenic
1062620232 9:137417245-137417267 ACTGGCCATCCCCGTCCCTGCGG - Intronic
1185782624 X:2862395-2862417 ACTGAGCATCTGTCTCCTTGTGG - Intronic
1188423414 X:30016327-30016349 ACTGGCCATCAGAATCCCTTGGG - Intergenic
1189629281 X:42934424-42934446 ACTGCCCATCTCTCTCCCTGGGG - Intergenic
1193021492 X:76797932-76797954 AATGGCTTTCTGTCTCCCTGAGG - Intergenic
1200097716 X:153672002-153672024 GCTCGCCACCCGTCACCCTGGGG + Exonic
1200933326 Y:8716511-8716533 ACTGGCCCTCCCTCTGCTTGGGG - Intergenic
1201343794 Y:12960660-12960682 ACTAGCCATCCTTGCCCCTGCGG + Intergenic