ID: 968551609

View in Genome Browser
Species Human (GRCh38)
Location 4:1226327-1226349
Sequence ACTGGCCATCCGTCTCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 138}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968551599_968551609 11 Left 968551599 4:1226293-1226315 CCACCCCATCCGGATGATTGCAT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 968551609 4:1226327-1226349 ACTGGCCATCCGTCTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 138
968551596_968551609 26 Left 968551596 4:1226278-1226300 CCTGCACGGCACTTCCCACCCCA 0: 1
1: 0
2: 3
3: 17
4: 308
Right 968551609 4:1226327-1226349 ACTGGCCATCCGTCTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 138
968551595_968551609 27 Left 968551595 4:1226277-1226299 CCCTGCACGGCACTTCCCACCCC 0: 1
1: 1
2: 2
3: 23
4: 311
Right 968551609 4:1226327-1226349 ACTGGCCATCCGTCTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 138
968551602_968551609 6 Left 968551602 4:1226298-1226320 CCATCCGGATGATTGCATTCCTG 0: 1
1: 0
2: 0
3: 4
4: 105
Right 968551609 4:1226327-1226349 ACTGGCCATCCGTCTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 138
968551598_968551609 12 Left 968551598 4:1226292-1226314 CCCACCCCATCCGGATGATTGCA 0: 1
1: 0
2: 0
3: 5
4: 84
Right 968551609 4:1226327-1226349 ACTGGCCATCCGTCTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 138
968551594_968551609 28 Left 968551594 4:1226276-1226298 CCCCTGCACGGCACTTCCCACCC 0: 1
1: 1
2: 2
3: 23
4: 305
Right 968551609 4:1226327-1226349 ACTGGCCATCCGTCTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 138
968551600_968551609 8 Left 968551600 4:1226296-1226318 CCCCATCCGGATGATTGCATTCC 0: 1
1: 0
2: 4
3: 46
4: 187
Right 968551609 4:1226327-1226349 ACTGGCCATCCGTCTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 138
968551603_968551609 2 Left 968551603 4:1226302-1226324 CCGGATGATTGCATTCCTGTGTC No data
Right 968551609 4:1226327-1226349 ACTGGCCATCCGTCTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 138
968551601_968551609 7 Left 968551601 4:1226297-1226319 CCCATCCGGATGATTGCATTCCT 0: 1
1: 0
2: 0
3: 5
4: 284
Right 968551609 4:1226327-1226349 ACTGGCCATCCGTCTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968551609 Original CRISPR ACTGGCCATCCGTCTCCCTG GGG Intronic