ID: 968551610

View in Genome Browser
Species Human (GRCh38)
Location 4:1226330-1226352
Sequence GGCCATCCGTCTCCCTGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 127}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968551598_968551610 15 Left 968551598 4:1226292-1226314 CCCACCCCATCCGGATGATTGCA 0: 1
1: 0
2: 0
3: 5
4: 84
Right 968551610 4:1226330-1226352 GGCCATCCGTCTCCCTGGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 127
968551605_968551610 -10 Left 968551605 4:1226317-1226339 CCTGTGTCCGACTGGCCATCCGT 0: 1
1: 0
2: 0
3: 2
4: 32
Right 968551610 4:1226330-1226352 GGCCATCCGTCTCCCTGGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 127
968551601_968551610 10 Left 968551601 4:1226297-1226319 CCCATCCGGATGATTGCATTCCT 0: 1
1: 0
2: 0
3: 5
4: 284
Right 968551610 4:1226330-1226352 GGCCATCCGTCTCCCTGGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 127
968551603_968551610 5 Left 968551603 4:1226302-1226324 CCGGATGATTGCATTCCTGTGTC No data
Right 968551610 4:1226330-1226352 GGCCATCCGTCTCCCTGGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 127
968551596_968551610 29 Left 968551596 4:1226278-1226300 CCTGCACGGCACTTCCCACCCCA 0: 1
1: 0
2: 3
3: 17
4: 308
Right 968551610 4:1226330-1226352 GGCCATCCGTCTCCCTGGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 127
968551600_968551610 11 Left 968551600 4:1226296-1226318 CCCCATCCGGATGATTGCATTCC 0: 1
1: 0
2: 4
3: 46
4: 187
Right 968551610 4:1226330-1226352 GGCCATCCGTCTCCCTGGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 127
968551599_968551610 14 Left 968551599 4:1226293-1226315 CCACCCCATCCGGATGATTGCAT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 968551610 4:1226330-1226352 GGCCATCCGTCTCCCTGGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 127
968551602_968551610 9 Left 968551602 4:1226298-1226320 CCATCCGGATGATTGCATTCCTG 0: 1
1: 0
2: 0
3: 4
4: 105
Right 968551610 4:1226330-1226352 GGCCATCCGTCTCCCTGGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 127
968551595_968551610 30 Left 968551595 4:1226277-1226299 CCCTGCACGGCACTTCCCACCCC 0: 1
1: 1
2: 2
3: 23
4: 311
Right 968551610 4:1226330-1226352 GGCCATCCGTCTCCCTGGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968551610 Original CRISPR GGCCATCCGTCTCCCTGGGG AGG Intronic