ID: 968551610

View in Genome Browser
Species Human (GRCh38)
Location 4:1226330-1226352
Sequence GGCCATCCGTCTCCCTGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 127}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968551601_968551610 10 Left 968551601 4:1226297-1226319 CCCATCCGGATGATTGCATTCCT 0: 1
1: 0
2: 0
3: 5
4: 284
Right 968551610 4:1226330-1226352 GGCCATCCGTCTCCCTGGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 127
968551602_968551610 9 Left 968551602 4:1226298-1226320 CCATCCGGATGATTGCATTCCTG 0: 1
1: 0
2: 0
3: 4
4: 105
Right 968551610 4:1226330-1226352 GGCCATCCGTCTCCCTGGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 127
968551598_968551610 15 Left 968551598 4:1226292-1226314 CCCACCCCATCCGGATGATTGCA 0: 1
1: 0
2: 0
3: 5
4: 84
Right 968551610 4:1226330-1226352 GGCCATCCGTCTCCCTGGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 127
968551605_968551610 -10 Left 968551605 4:1226317-1226339 CCTGTGTCCGACTGGCCATCCGT 0: 1
1: 0
2: 0
3: 2
4: 32
Right 968551610 4:1226330-1226352 GGCCATCCGTCTCCCTGGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 127
968551599_968551610 14 Left 968551599 4:1226293-1226315 CCACCCCATCCGGATGATTGCAT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 968551610 4:1226330-1226352 GGCCATCCGTCTCCCTGGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 127
968551595_968551610 30 Left 968551595 4:1226277-1226299 CCCTGCACGGCACTTCCCACCCC 0: 1
1: 1
2: 2
3: 23
4: 311
Right 968551610 4:1226330-1226352 GGCCATCCGTCTCCCTGGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 127
968551596_968551610 29 Left 968551596 4:1226278-1226300 CCTGCACGGCACTTCCCACCCCA 0: 1
1: 0
2: 3
3: 17
4: 308
Right 968551610 4:1226330-1226352 GGCCATCCGTCTCCCTGGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 127
968551603_968551610 5 Left 968551603 4:1226302-1226324 CCGGATGATTGCATTCCTGTGTC 0: 1
1: 0
2: 2
3: 9
4: 144
Right 968551610 4:1226330-1226352 GGCCATCCGTCTCCCTGGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 127
968551600_968551610 11 Left 968551600 4:1226296-1226318 CCCCATCCGGATGATTGCATTCC 0: 1
1: 0
2: 4
3: 46
4: 187
Right 968551610 4:1226330-1226352 GGCCATCCGTCTCCCTGGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968551610 Original CRISPR GGCCATCCGTCTCCCTGGGG AGG Intronic
900114816 1:1023981-1024003 GGCCACCGGACCCCCTGGGGTGG + Intronic
900680098 1:3911884-3911906 GCCCATCTGTCTCCCTTGAGGGG + Intergenic
900751213 1:4398987-4399009 GGCCATCGTTCTCCCTGGAGGGG + Intergenic
902817854 1:18926336-18926358 GGCCATCCCTCCCCCTGGCCTGG - Intronic
903133386 1:21293511-21293533 GGACATCAGAGTCCCTGGGGTGG - Intronic
906136938 1:43506464-43506486 GCCCAACCTTCTGCCTGGGGCGG + Intergenic
920194685 1:204218996-204219018 GGCCATCCCTCCTCCTGGGGAGG + Exonic
1062966099 10:1608905-1608927 GGCCATCCGGCACCCTGCAGGGG - Intronic
1066746066 10:38604790-38604812 GTCCCTCCCACTCCCTGGGGGGG + Intergenic
1067433075 10:46256629-46256651 GGCCTTCTGCCTCCCTGTGGTGG - Intergenic
1068884510 10:62084864-62084886 TGCCTTCCTTCTCGCTGGGGCGG + Intronic
1072228256 10:93389883-93389905 GTCCATCCCTCTCCCATGGGGGG - Intronic
1075398254 10:122143050-122143072 GGCCACCCGTGTCCTGGGGGAGG - Intronic
1075640129 10:124058634-124058656 GGCCACCCGTCTCCCTTGTAAGG + Intronic
1077366618 11:2163802-2163824 GGCCAGCCATCTCCCAGAGGAGG + Intergenic
1077368998 11:2172841-2172863 GGGCATCACTCTCCCTGGGTGGG - Intergenic
1077435097 11:2535147-2535169 GAGCCTCTGTCTCCCTGGGGTGG - Intronic
1078186967 11:9060375-9060397 GGCACCCAGTCTCCCTGGGGAGG + Intronic
1078682516 11:13490580-13490602 GGACATCCGTTTTGCTGGGGTGG + Intergenic
1083308217 11:61771742-61771764 GGCCAGCCATGTACCTGGGGAGG - Exonic
1083632195 11:64101564-64101586 GGTCATCCGCCTCCCTGGCCGGG - Intronic
1084190396 11:67496030-67496052 GGCGCTCCTTCCCCCTGGGGGGG - Intronic
1084357800 11:68651393-68651415 TGCCATCAGAATCCCTGGGGAGG - Intergenic
1084410834 11:69005134-69005156 GGGCCTCCTTCTCCCTGGGCTGG - Exonic
1089497408 11:118914614-118914636 GGCCTTCTGTCTCCCTGCAGAGG - Intronic
1090271095 11:125387023-125387045 GGGCATCCGTTTCCCTGGCTGGG + Intronic
1091006116 11:131955417-131955439 GGCCTTCCCTCTCCTTGGAGAGG + Intronic
1092029729 12:5274296-5274318 AGCCTTCCGTCTCTCAGGGGTGG + Intergenic
1102200634 12:111055573-111055595 GGCCGTCTGCCTCCCTGGAGGGG + Intronic
1104625013 12:130344861-130344883 GGCCATCCCTAACCATGGGGAGG + Intronic
1106407733 13:29488290-29488312 GGACATCAGAATCCCTGGGGTGG - Intronic
1112200526 13:97269592-97269614 GGCCAACAGTCACCCTGGGTGGG - Intronic
1113490011 13:110684107-110684129 GGCCATGTGTCTCCCTAGGAAGG + Intronic
1113649992 13:112028102-112028124 GGCCATCCTCCTTCCTGGCGGGG - Intergenic
1113650024 13:112028206-112028228 GGCCATCCTCCTTCCTGGTGGGG - Intergenic
1118472801 14:66090683-66090705 GGCCATGTGGCTTCCTGGGGTGG - Intergenic
1121326687 14:93024292-93024314 GGGCATCCTTCTGCCTGGGGAGG - Intronic
1121921769 14:97888556-97888578 GTCCCTCCGTCTGCCTGGGGTGG + Intergenic
1122862864 14:104590252-104590274 GCCCATCCTCCTTCCTGGGGTGG - Intronic
1128240389 15:66097312-66097334 GGCCATCCCTGGCGCTGGGGCGG + Intronic
1128777094 15:70328880-70328902 GGCCACCCCTCTTCCTCGGGTGG - Intergenic
1129136226 15:73554597-73554619 TCCCATCCCCCTCCCTGGGGTGG - Intronic
1129680933 15:77657991-77658013 GGCCATCTGTTTCCCGGGGGTGG + Intronic
1132528042 16:427014-427036 GGCGATCAGGCCCCCTGGGGGGG - Intronic
1136275574 16:29177490-29177512 GGCCATGCATCTCCCTGCAGCGG + Intergenic
1136374865 16:29859375-29859397 GGGCCTCCATCTCCCTGGGCAGG + Intronic
1136408144 16:30061149-30061171 GGTCATCCCTGTCCCAGGGGAGG + Intronic
1136555623 16:31006254-31006276 GTCCATCTGTCTCCCTGGCTGGG + Intronic
1136736995 16:32474854-32474876 GTCCCTCCCACTCCCTGGGGGGG - Intergenic
1136990919 16:35151032-35151054 GGCCATCCCCCTCCCTGAGCAGG + Intergenic
1137493151 16:48949842-48949864 GTCACTCCCTCTCCCTGGGGAGG - Intergenic
1138457341 16:57128998-57129020 GGCCATCAGGCTTCCTGGAGGGG + Intronic
1139636525 16:68261502-68261524 TGCCATCTGTACCCCTGGGGAGG + Intergenic
1141697694 16:85627945-85627967 CCGCATCGGTCTCCCTGGGGAGG + Intronic
1141892784 16:86938231-86938253 AGGCATCCGTGACCCTGGGGAGG - Intergenic
1203016076 16_KI270728v1_random:354723-354745 GTCCCTCCCACTCCCTGGGGGGG + Intergenic
1203034411 16_KI270728v1_random:627881-627903 GTCCCTCCCACTCCCTGGGGGGG + Intergenic
1143150047 17:4802128-4802150 GATCATCTGTCTCCCTGGGTGGG - Intergenic
1144494419 17:15737417-15737439 AGCCATCCCTCTCCCTGAGAGGG - Intronic
1144905846 17:18639259-18639281 AGCCATCCCTCTCCCTGAGAGGG + Intronic
1146369783 17:32258402-32258424 GGTCATCCATCTTTCTGGGGTGG - Intergenic
1150072874 17:62167561-62167583 GGCCTTCCTTTCCCCTGGGGAGG + Intergenic
1152738951 17:82010852-82010874 GCCCACCTGTCTCGCTGGGGCGG - Exonic
1153018538 18:606236-606258 GGCCGTCCTTCTCCCTGTTGTGG - Intronic
1154379824 18:13838937-13838959 GGCCATTCCTCTCACTGTGGGGG - Intergenic
1154470174 18:14693134-14693156 GGCTCTGCGTCTCTCTGGGGTGG - Intergenic
1160373252 18:78391417-78391439 GCACAGCCGTCCCCCTGGGGTGG - Intergenic
1160827962 19:1089515-1089537 TGCCAGCCGTCTCACTGGGCCGG + Exonic
1161015211 19:1979857-1979879 GCCCATGCCCCTCCCTGGGGCGG - Intronic
1164151789 19:22560204-22560226 GGCCCTCAGACTCACTGGGGAGG - Intergenic
927184144 2:20470057-20470079 GGGCATCTGTCTCCCTGGCTTGG + Intergenic
929917332 2:46146971-46146993 GGCCTTCCTTCTTCCTGGGATGG - Intronic
932001414 2:67888740-67888762 GGCCCCCAGCCTCCCTGGGGTGG + Intergenic
932439217 2:71721203-71721225 GACCATCCTTCACCCCGGGGAGG + Intergenic
934308469 2:91843982-91844004 GTCCCTCCCACTCCCTGGGGGGG + Intergenic
934879260 2:97959299-97959321 GGTCATCTGTGTCTCTGGGGAGG + Intronic
935328007 2:101955352-101955374 GGCCATCCCTCAGGCTGGGGTGG - Intergenic
938389547 2:130894013-130894035 GGCCAGCCGTCGCCCTGATGGGG + Intronic
939079487 2:137642520-137642542 GGCCGTCCTTCTCCTTGGGTTGG - Exonic
942686717 2:178540303-178540325 GGACATCAGTCTCCCTGGCCTGG - Exonic
948518073 2:238518716-238518738 GACCCTCCGTTTGCCTGGGGAGG - Intergenic
1172615134 20:36278333-36278355 AACCATCCTTGTCCCTGGGGAGG + Intergenic
1172767700 20:37359539-37359561 AGCCATGCAGCTCCCTGGGGAGG + Intronic
1176422636 21:6528228-6528250 GAGCGTCTGTCTCCCTGGGGAGG - Intergenic
1176804322 21:13464731-13464753 GGCTCTGCGTCTCTCTGGGGTGG + Intergenic
1179492035 21:41746882-41746904 GGGGAGCCGTCTCCCTGGGGTGG - Intronic
1179698129 21:43136544-43136566 GAGCGTCTGTCTCCCTGGGGAGG - Intergenic
1179828407 21:43981378-43981400 GGCCGTTCGGCTCTCTGGGGAGG - Intronic
1179953395 21:44724134-44724156 ACCCTTCCGTCTCCCTGGGTGGG - Intergenic
1180258752 21:46651613-46651635 GTCCCTCAGTCTCCCTGGGGGGG - Intronic
1181478892 22:23185111-23185133 GCTCATCTGTCGCCCTGGGGTGG + Intronic
1181634471 22:24168204-24168226 GCCCATCCATCTCCCAGGTGGGG - Intronic
1182352575 22:29707084-29707106 GGCCAGCCGGCTCCTCGGGGTGG - Intergenic
1185377747 22:50489894-50489916 GGCCCTCCGCCTGCCTGGAGAGG + Exonic
951033053 3:17904213-17904235 GGTCACCCTTCTCCCTGGAGAGG - Intronic
955204334 3:56881909-56881931 GGCCATCCGGCTGCCTGAGCTGG + Intronic
961749366 3:129086409-129086431 GGCCTTCCTTCTCCCTGGGAAGG + Intergenic
961756019 3:129127857-129127879 GGCCTTCCTTCTCCCTGGGAAGG - Intronic
967045461 3:185732586-185732608 GGCCAGCCGTCTCCCTAGGGAGG - Intronic
967144080 3:186591322-186591344 GCTCATCCCTCTTCCTGGGGAGG + Intronic
968088524 3:195885515-195885537 GGGCAGCCGACTCCCTGGTGAGG - Intronic
968289364 3:197526707-197526729 GGCTATCCTTCTACCTGGGCAGG - Intronic
968551610 4:1226330-1226352 GGCCATCCGTCTCCCTGGGGAGG + Intronic
968772075 4:2513831-2513853 GTCCATCCGTCTCTCCTGGGGGG - Exonic
985208633 4:187568373-187568395 AGCCTTCAGTCTCCCTAGGGTGG + Intergenic
986307079 5:6523930-6523952 CGCCATCCGTCTCCCTGAGAAGG - Intergenic
1002456768 5:179349764-179349786 GGCCATCCTTCTACCTGGTTGGG - Intergenic
1017345030 6:153370177-153370199 GGACCTGCGTCTCTCTGGGGTGG + Intergenic
1018202576 6:161409370-161409392 GGCCATATGTCTCCCTGAGTAGG + Intronic
1019134568 6:169899964-169899986 GGCCACCAGGGTCCCTGGGGAGG - Intergenic
1019531928 7:1507640-1507662 GGCGTTCCGTCATCCTGGGGGGG + Intergenic
1022902425 7:34824479-34824501 GGCCATCAGTCTCCCTGCTGTGG + Intronic
1023983633 7:45083080-45083102 GGCCCTCAGTCTCCCTGAGCCGG - Exonic
1029350845 7:100011847-100011869 CCCCTTCCCTCTCCCTGGGGTGG - Intergenic
1033349021 7:140546763-140546785 CTCCTTCCTTCTCCCTGGGGAGG - Intronic
1033600542 7:142885608-142885630 GGCCCACCGTCTCCCTGTAGAGG + Exonic
1034690318 7:153008516-153008538 GGACATCCTGCTCCCAGGGGAGG + Intergenic
1037388329 8:18365982-18366004 GGCTCTTCGTTTCCCTGGGGTGG + Intergenic
1037810183 8:22082178-22082200 GGCCTTCCGCCTCCCTTGGATGG + Exonic
1037827622 8:22168610-22168632 GGCCAGGCGTCCCCCTGGGTGGG - Intronic
1038866226 8:31441274-31441296 GGCCATCAGACTCCCATGGGTGG - Intergenic
1040795420 8:51285271-51285293 GGCCAACCATCCCCCTGGGCTGG + Intergenic
1042559386 8:70061612-70061634 GGCCTTCCTGCTTCCTGGGGTGG + Intronic
1043217907 8:77619115-77619137 TACCATCCTTCTACCTGGGGAGG - Intergenic
1049299195 8:141860907-141860929 GGCCATCCATCTCCCTTTGCTGG + Intergenic
1049693132 8:143971458-143971480 GGCCCTTCCTGTCCCTGGGGTGG - Intronic
1050878768 9:10674375-10674397 GGCTATGTGTTTCCCTGGGGAGG - Intergenic
1054707647 9:68479425-68479447 GGCCATCCTTCTCTCGGAGGTGG - Exonic
1058804328 9:108576701-108576723 GGCCAGCCTGCTCCCTGTGGTGG + Intergenic
1059380471 9:113919635-113919657 GGCCAGCCCTCTCCGTGAGGAGG + Intronic
1060666995 9:125437882-125437904 TGCCGTCCGGCTCCCTGGGTGGG - Exonic
1060791560 9:126488985-126489007 GGCCATCTGTGTCCTTGTGGGGG - Intronic
1061400987 9:130368283-130368305 GGCCAGCCCCCTCCCCGGGGAGG - Intronic
1061867320 9:133499501-133499523 GACCATCCGTCACCGTGTGGGGG + Intergenic
1061906515 9:133702119-133702141 TGTCACGCGTCTCCCTGGGGTGG + Intronic
1062341235 9:136094802-136094824 GGCCAGTCGGGTCCCTGGGGAGG + Intronic
1190370859 X:49739489-49739511 GGCCAGCCTTCCTCCTGGGGAGG - Intergenic
1192535418 X:71923181-71923203 TGCCATCCCTCTACCTGGAGGGG - Intergenic
1197725123 X:129771113-129771135 GGCCATCTGGGTCCCAGGGGAGG - Intergenic
1200985848 Y:9303283-9303305 GGGCATCTGGCTTCCTGGGGTGG + Intergenic