ID: 968551612

View in Genome Browser
Species Human (GRCh38)
Location 4:1226333-1226355
Sequence CATCCGTCTCCCTGGGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 234}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968551599_968551612 17 Left 968551599 4:1226293-1226315 CCACCCCATCCGGATGATTGCAT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 968551612 4:1226333-1226355 CATCCGTCTCCCTGGGGAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 234
968551601_968551612 13 Left 968551601 4:1226297-1226319 CCCATCCGGATGATTGCATTCCT 0: 1
1: 0
2: 0
3: 5
4: 284
Right 968551612 4:1226333-1226355 CATCCGTCTCCCTGGGGAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 234
968551605_968551612 -7 Left 968551605 4:1226317-1226339 CCTGTGTCCGACTGGCCATCCGT 0: 1
1: 0
2: 0
3: 2
4: 32
Right 968551612 4:1226333-1226355 CATCCGTCTCCCTGGGGAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 234
968551602_968551612 12 Left 968551602 4:1226298-1226320 CCATCCGGATGATTGCATTCCTG 0: 1
1: 0
2: 0
3: 4
4: 105
Right 968551612 4:1226333-1226355 CATCCGTCTCCCTGGGGAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 234
968551598_968551612 18 Left 968551598 4:1226292-1226314 CCCACCCCATCCGGATGATTGCA 0: 1
1: 0
2: 0
3: 5
4: 84
Right 968551612 4:1226333-1226355 CATCCGTCTCCCTGGGGAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 234
968551603_968551612 8 Left 968551603 4:1226302-1226324 CCGGATGATTGCATTCCTGTGTC No data
Right 968551612 4:1226333-1226355 CATCCGTCTCCCTGGGGAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 234
968551600_968551612 14 Left 968551600 4:1226296-1226318 CCCCATCCGGATGATTGCATTCC 0: 1
1: 0
2: 4
3: 46
4: 187
Right 968551612 4:1226333-1226355 CATCCGTCTCCCTGGGGAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968551612 Original CRISPR CATCCGTCTCCCTGGGGAGG AGG Intronic