ID: 968551612

View in Genome Browser
Species Human (GRCh38)
Location 4:1226333-1226355
Sequence CATCCGTCTCCCTGGGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 234}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968551602_968551612 12 Left 968551602 4:1226298-1226320 CCATCCGGATGATTGCATTCCTG 0: 1
1: 0
2: 0
3: 4
4: 105
Right 968551612 4:1226333-1226355 CATCCGTCTCCCTGGGGAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 234
968551600_968551612 14 Left 968551600 4:1226296-1226318 CCCCATCCGGATGATTGCATTCC 0: 1
1: 0
2: 4
3: 46
4: 187
Right 968551612 4:1226333-1226355 CATCCGTCTCCCTGGGGAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 234
968551599_968551612 17 Left 968551599 4:1226293-1226315 CCACCCCATCCGGATGATTGCAT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 968551612 4:1226333-1226355 CATCCGTCTCCCTGGGGAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 234
968551598_968551612 18 Left 968551598 4:1226292-1226314 CCCACCCCATCCGGATGATTGCA 0: 1
1: 0
2: 0
3: 5
4: 84
Right 968551612 4:1226333-1226355 CATCCGTCTCCCTGGGGAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 234
968551603_968551612 8 Left 968551603 4:1226302-1226324 CCGGATGATTGCATTCCTGTGTC 0: 1
1: 0
2: 2
3: 9
4: 144
Right 968551612 4:1226333-1226355 CATCCGTCTCCCTGGGGAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 234
968551605_968551612 -7 Left 968551605 4:1226317-1226339 CCTGTGTCCGACTGGCCATCCGT 0: 1
1: 0
2: 0
3: 2
4: 32
Right 968551612 4:1226333-1226355 CATCCGTCTCCCTGGGGAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 234
968551601_968551612 13 Left 968551601 4:1226297-1226319 CCCATCCGGATGATTGCATTCCT 0: 1
1: 0
2: 0
3: 5
4: 284
Right 968551612 4:1226333-1226355 CATCCGTCTCCCTGGGGAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968551612 Original CRISPR CATCCGTCTCCCTGGGGAGG AGG Intronic
900157719 1:1210202-1210224 CATCTGTGTCCCTCGGGAGGCGG - Intergenic
900680101 1:3911887-3911909 CATCTGTCTCCCTTGAGGGGAGG + Intergenic
900867324 1:5277600-5277622 CCTCCCTCTCCCTGGGGAGAAGG - Intergenic
901001068 1:6149066-6149088 CCTCCTTCTCCTGGGGGAGGAGG + Exonic
901460358 1:9387569-9387591 CATTCCTGTCCCTGGGGAGGAGG - Intergenic
901628736 1:10638292-10638314 CCTCGGTTTCCCTGGGGCGGAGG + Exonic
901838547 1:11939396-11939418 CAGTCTGCTCCCTGGGGAGGCGG - Intronic
902684417 1:18066713-18066735 CATCTGTCTCACTGGGGAGTAGG - Intergenic
903190965 1:21655838-21655860 CTTCCATCTCCCTGGAAAGGGGG - Intronic
903336655 1:22628907-22628929 CATCAGAATCCCCGGGGAGGTGG - Intergenic
904034509 1:27551566-27551588 CATCCGTAGCCCTGAGGAGCGGG - Exonic
904756287 1:32770536-32770558 CCACTGCCTCCCTGGGGAGGGGG - Exonic
906510503 1:46407979-46408001 TCTCCCTCTGCCTGGGGAGGGGG - Intronic
909853270 1:80496146-80496168 AAGCCGTTTCCCTGGGGAGATGG + Intergenic
910339829 1:86173310-86173332 CATCAGTTTCCCTTGTGAGGAGG - Intergenic
912982390 1:114387374-114387396 CACCAGTTTCCCTGAGGAGGGGG + Intergenic
914455625 1:147833708-147833730 CCTCCTTCTCCCTGTGGAGAAGG + Intergenic
915440227 1:155941348-155941370 CAGCTCTCTCCCTGGGGTGGAGG + Intergenic
919655476 1:200193177-200193199 CATCCGGCTCCCAGGGATGGAGG + Intergenic
920194689 1:204218999-204219021 CATCCCTCCTCCTGGGGAGGGGG + Exonic
920367899 1:205457544-205457566 CTTCCGCCTCCTTGGGAAGGGGG - Intergenic
921444957 1:215235025-215235047 CATCCCTCTCGCTGGTCAGGTGG - Exonic
922705231 1:227787097-227787119 CACCGGCCTCCCTGCGGAGGAGG + Intergenic
923715967 1:236425074-236425096 AGTCGGTCTCCCTGGGGATGGGG + Intronic
924432915 1:244012454-244012476 TATCTCTCTCCCTGGGAAGGAGG + Intergenic
1066367480 10:34791421-34791443 GAGCCGGCTTCCTGGGGAGGAGG - Intronic
1067042508 10:42962545-42962567 CAGCAGGCTCCCTGGGCAGGAGG - Intergenic
1068859371 10:61830993-61831015 CATTCGTATCTCTGGGGAAGAGG - Intergenic
1069635743 10:69923790-69923812 CCTGCTTCTCCCTGGGGAAGAGG - Exonic
1069800941 10:71081067-71081089 CATCATTCTCCCTGGGGTGCAGG + Intergenic
1069863263 10:71484341-71484363 CCTCCATCTCCCAGGGGAGCAGG + Intronic
1070577988 10:77694342-77694364 CAGCCTTCTCCCTGGAGAGACGG - Intergenic
1073125663 10:101147216-101147238 GTTTCGGCTCCCTGGGGAGGAGG - Intergenic
1074301213 10:112234801-112234823 AATCCGTCTGCCTCGGGAGAAGG + Intergenic
1074574688 10:114657398-114657420 CATCCCTCTGCCTGGGAAAGAGG - Intronic
1075640131 10:124058637-124058659 CACCCGTCTCCCTTGTAAGGAGG + Intronic
1075669838 10:124256824-124256846 CATCAGTCACCTTGGGGAGCTGG + Intergenic
1076675524 10:132145733-132145755 CATCAGGAGCCCTGGGGAGGAGG + Intronic
1077541055 11:3146695-3146717 CAGGCTTCTCTCTGGGGAGGGGG + Intronic
1082879356 11:58023077-58023099 TATCACCCTCCCTGGGGAGGTGG + Intergenic
1083204330 11:61139012-61139034 CCTTGATCTCCCTGGGGAGGGGG - Intronic
1083308213 11:61771739-61771761 CAGCCATGTACCTGGGGAGGGGG - Exonic
1083448916 11:62729311-62729333 CATCCGAATCTCTGGGGATGGGG - Intronic
1086150333 11:83602007-83602029 CATCCTTCTTCCTGAGGAAGAGG - Intronic
1086366996 11:86117238-86117260 TATCCTTCTCCATGGAGAGGCGG - Intergenic
1088884889 11:113998866-113998888 CATCCTTCTTCCTGGGGGAGGGG - Intergenic
1089171162 11:116512517-116512539 CATACCTCTTCCAGGGGAGGAGG - Intergenic
1089628671 11:119769964-119769986 CATCTGGCTTCATGGGGAGGTGG + Intergenic
1090113603 11:123942665-123942687 CAGCCTTCTCTGTGGGGAGGAGG + Intergenic
1090134664 11:124184924-124184946 CATCCTTCTACCCCGGGAGGAGG + Intergenic
1090213067 11:124936413-124936435 ACTCCTTCTCCCTGAGGAGGAGG + Intergenic
1090586542 11:128219314-128219336 CTTCCTTCTCCCTGGGAAGTCGG + Intergenic
1091113599 11:132993994-132994016 CAGACGTCTCCCTGCGGAGGTGG - Intronic
1092100428 12:5879113-5879135 CATCCTTATACCTGGGGAGCAGG - Intronic
1092247344 12:6871131-6871153 CACCCCTCCCCTTGGGGAGGTGG - Exonic
1093711800 12:22335885-22335907 CATCCGTCTCCACTGAGAGGTGG + Intronic
1096475596 12:51907239-51907261 CATCCGCCTCCCCGAGGGGGCGG - Intronic
1100613571 12:96212849-96212871 CATCTTTCTCGCGGGGGAGGGGG + Intronic
1101616401 12:106342238-106342260 CATCCTTATCCCTGGGGACATGG + Intronic
1102347568 12:112169515-112169537 CATCCGCTTCACTGGCGAGGAGG - Exonic
1103373936 12:120440451-120440473 CAGCCGTTTCCCTGGGGAGATGG + Exonic
1104835316 12:131786492-131786514 CCTCCGTCTCTCAGGGGAGTGGG - Exonic
1104863830 12:131941144-131941166 CATCGGCTTCTCTGGGGAGGGGG - Intronic
1107691917 13:42961854-42961876 CAGCCATTTGCCTGGGGAGGAGG + Intronic
1113490013 13:110684110-110684132 CATGTGTCTCCCTAGGAAGGAGG + Intronic
1113731375 13:112644131-112644153 CACCAGTCTCCCTGGAGTGGTGG + Intergenic
1114368020 14:22050904-22050926 CATCTGTCTCCCAGGTGAAGAGG + Intergenic
1114678029 14:24458531-24458553 CATCAGCCTCCCTGGAGATGAGG - Intergenic
1116959120 14:50952127-50952149 CCTGCGCCTCCCTGGGGATGAGG - Intergenic
1118137351 14:63045020-63045042 CATCCCTCTCCCAAGGGGGGAGG - Intronic
1122153029 14:99734814-99734836 CATCTGTATCCCCGGGGAGGGGG - Intergenic
1122641293 14:103161024-103161046 CTCCCAGCTCCCTGGGGAGGAGG + Intergenic
1125543575 15:40486837-40486859 CCTCCGTCTACCTGGGGGGAAGG - Intergenic
1128451693 15:67809581-67809603 CACCTGTATCCCTGGGGAGCTGG - Intergenic
1129172602 15:73817299-73817321 CATCGGTCCCTGTGGGGAGGAGG - Intergenic
1130116744 15:81012121-81012143 CATCCTTCTCCCTGGTCAGCAGG - Intronic
1131495306 15:92904463-92904485 CGTGCGGCTCCCTGGGTAGGGGG - Intronic
1131527828 15:93166757-93166779 CCTTCGGCTCCCTGGGGATGGGG - Intergenic
1132988216 16:2779050-2779072 CAGGCGTCTCCCTGTGGAGACGG - Intergenic
1134249073 16:12561821-12561843 CATCCTTCTCCCTGCAGGGGAGG + Intronic
1136083384 16:27867660-27867682 CAACCCACTCCCTGGGGAGCTGG + Intronic
1136501175 16:30670263-30670285 CAGGCTTCTCCCTGGGAAGGTGG + Exonic
1136736990 16:32474851-32474873 CCTCCCACTCCCTGGGGGGGGGG - Intergenic
1203016081 16_KI270728v1_random:354726-354748 CCTCCCACTCCCTGGGGGGGGGG + Intergenic
1203034416 16_KI270728v1_random:627884-627906 CCTCCCACTCCCTGGGGGGGGGG + Intergenic
1143378270 17:6479931-6479953 CATCCGTCTTCCTGGAGATAGGG + Intronic
1144298189 17:13899283-13899305 CATCTGACTCCCTGGGTCGGAGG - Intergenic
1144826247 17:18107269-18107291 GCCTCGTCTCCCTGGGGAGGTGG + Exonic
1146301354 17:31692086-31692108 CATGCCTCTCCCAGGCGAGGTGG - Intergenic
1147327400 17:39676084-39676106 CATGCCTGTCTCTGGGGAGGGGG - Intronic
1147447551 17:40483922-40483944 CATCTGTCTCCCTAGTGAGGTGG + Intronic
1147805225 17:43126426-43126448 CTTCCCGCCCCCTGGGGAGGCGG - Intergenic
1148203913 17:45767805-45767827 CATCCTTCTGCCAAGGGAGGGGG - Intergenic
1150110648 17:62496488-62496510 CATTCTTCTCCATGGAGAGGAGG + Intronic
1150837367 17:68576544-68576566 GGTCTCTCTCCCTGGGGAGGAGG - Intronic
1151547519 17:74802157-74802179 CAACCCTCTCCCTGAGCAGGAGG - Intronic
1151914147 17:77105117-77105139 CATCCGTCTCAGTGAGCAGGGGG + Intronic
1151987996 17:77556360-77556382 GATCCGTGTCCCTGGGGGCGAGG + Intergenic
1152614542 17:81331697-81331719 CAACTGTGTCCCAGGGGAGGGGG + Intergenic
1152657611 17:81527297-81527319 CTCCCGTCTCCCTGGGGACTGGG - Intergenic
1152773975 17:82188382-82188404 CATCCTTCTCCCTGGCCAGACGG + Exonic
1154230223 18:12549754-12549776 TATCCTTCTTCCTAGGGAGGCGG + Intronic
1155219177 18:23669025-23669047 CCTTCTTTTCCCTGGGGAGGAGG + Intergenic
1156287024 18:35706710-35706732 CCTCCCTCTCCCTGGGCAGAGGG + Intronic
1157223119 18:45841143-45841165 CAGCAGATTCCCTGGGGAGGGGG + Intronic
1157237883 18:45981211-45981233 CATCTTCCTCCCTGGGGTGGTGG - Intergenic
1158230021 18:55244108-55244130 CCTCCAGCTCCCAGGGGAGGAGG + Intronic
1160373251 18:78391414-78391436 CAGCCGTCCCCCTGGGGTGGAGG - Intergenic
1160819945 19:1053260-1053282 CCCCAGTCTCCCTGGGGAAGAGG - Intronic
1161144314 19:2668503-2668525 CCTCCATCTCCCTGGGGTTGGGG - Intronic
1163749977 19:19070915-19070937 CACCTGTCTCCCTCGGAAGGTGG + Intronic
1163793284 19:19320816-19320838 CTTCCGCCTCCCTGTGGCGGCGG + Exonic
1164574285 19:29396628-29396650 CTCCCCTGTCCCTGGGGAGGAGG - Intergenic
1166798740 19:45443553-45443575 CAGGCGTCTCCCTTGGGATGGGG + Intronic
1167741453 19:51326937-51326959 CCCCCGAGTCCCTGGGGAGGAGG + Intronic
1167965149 19:53138228-53138250 CCTCAGTCTCCCTGAGGAGCTGG + Intronic
926101616 2:10122136-10122158 GATCCGTGTCCCTGCGGTGGGGG - Intergenic
928971962 2:37038890-37038912 ACTCTGTCTCCCTGGGGTGGGGG + Intronic
929353454 2:40990280-40990302 CCTCCTTCTCCCTGGGGACTAGG + Intergenic
930087000 2:47504632-47504654 CATGAGTCTCCCTGGTGAGTGGG - Intronic
931571333 2:63671967-63671989 AGTCCGTCTCTGTGGGGAGGTGG + Intronic
932418196 2:71586340-71586362 CATCTGTCTCCCTGAGGTAGAGG + Intronic
933767492 2:85720000-85720022 AAGCCGTCTCACTGGGGAGTTGG + Intergenic
933770572 2:85741578-85741600 CATCCTTGTTCCTGGGCAGGAGG + Intergenic
934037043 2:88096893-88096915 CAACTGTCACCCTGGGGAGGAGG + Intronic
934108133 2:88715155-88715177 AATCCGTCTCCCTGAGTAGTTGG + Intronic
934709966 2:96508342-96508364 CACCCGTCTCCCAGGGTGGGTGG + Intergenic
934879261 2:97959302-97959324 CATCTGTGTCTCTGGGGAGGTGG + Intronic
940203362 2:151175654-151175676 CAACCAGCTCCCTGAGGAGGGGG + Intergenic
941663497 2:168219442-168219464 CCTCCTTCTCCCTGAGGAAGTGG - Intronic
944599496 2:201289126-201289148 CATCAGACTCCCAGGGGAGATGG + Intronic
945185097 2:207132503-207132525 CATATGTTTCCTTGGGGAGGTGG + Intronic
945818859 2:214638506-214638528 CCCCCCACTCCCTGGGGAGGGGG + Intergenic
946431388 2:219628748-219628770 TGTCCGCCTGCCTGGGGAGGTGG + Intronic
947662880 2:231882868-231882890 CACCTTTCCCCCTGGGGAGGCGG - Intergenic
947739552 2:232478909-232478931 CATGCGTGGCCCTGCGGAGGAGG - Intergenic
948518070 2:238518713-238518735 CCTCCGTTTGCCTGGGGAGGCGG - Intergenic
948900719 2:240955697-240955719 CATCCCTGCCACTGGGGAGGAGG - Intronic
949059676 2:241949581-241949603 CCTCCGTCCCCCTTGTGAGGTGG - Intergenic
1170574384 20:17651654-17651676 CATCCGCTTCCCGGGGGTGGAGG - Intronic
1171131543 20:22658182-22658204 CATCCGTCTCCCAGGGTTGCAGG - Intergenic
1171262365 20:23746008-23746030 CATCTCTCTTCCTGGGGAAGTGG - Intergenic
1172589265 20:36105941-36105963 CAGCCTGCCCCCTGGGGAGGAGG - Intronic
1172697657 20:36833518-36833540 CATCCCTCTCCCTGAGGATCAGG - Intronic
1173188929 20:40861638-40861660 CATCAGTCACCCTGGGCTGGGGG + Intergenic
1173386822 20:42595957-42595979 CATAGGTCTTCCTGGTGAGGGGG + Intronic
1175503043 20:59463764-59463786 CCTCCCTCTACCTGAGGAGGTGG + Intergenic
1175546872 20:59783923-59783945 TATCCGTCTCCCTGGGGCCTGGG + Intronic
1175739759 20:61412407-61412429 CCTCCGGCACTCTGGGGAGGAGG - Intronic
1176738475 21:10574951-10574973 CATACGTATCTCTGGGAAGGGGG + Intronic
1180225351 21:46388801-46388823 CAGCCGTCACCCTGAGGAGCCGG + Exonic
1180825174 22:18856665-18856687 CCTTGGGCTCCCTGGGGAGGGGG - Intronic
1181063261 22:20292030-20292052 CCTGCATCTCCCTGGGGTGGGGG + Intergenic
1181187556 22:21117882-21117904 CCTTGGGCTCCCTGGGGAGGGGG + Intergenic
1181211642 22:21292611-21292633 CCTTGGGCTCCCTGGGGAGGGGG - Intergenic
1181397865 22:22634275-22634297 CCTTGGGCTCCCTGGGGAGGGGG + Intergenic
1181651542 22:24261783-24261805 CCTTGGGCTCCCTGGGGAGGGGG - Intergenic
1181705833 22:24648956-24648978 CCTTGGGCTCCCTGGGGAGGGGG + Intergenic
1183491756 22:38120608-38120630 CCTCTGCCTCCCTGGGAAGGGGG + Intronic
1183506531 22:38212336-38212358 CATCTGTCTCCAAGGGGAGGGGG - Intronic
1184038174 22:41928402-41928424 CAGCCCTGGCCCTGGGGAGGGGG - Intergenic
1184207428 22:43014370-43014392 CCTCCGTGTCCCGGGGGGGGGGG - Intronic
1184229524 22:43151325-43151347 CACCGGTCACCATGGGGAGGAGG + Intergenic
1203215311 22_KI270731v1_random:2821-2843 CCTTGGGCTCCCTGGGGAGGGGG + Intergenic
1203275319 22_KI270734v1_random:82568-82590 CCTTGGGCTCCCTGGGGAGGGGG - Intergenic
950648670 3:14393645-14393667 CCTCTGTTTCCCTGGGGAAGTGG + Intergenic
953735340 3:45489442-45489464 AATCAGTATCCCTGGGGTGGGGG - Intronic
953882999 3:46701225-46701247 CCTCAGTGTCCCTGGGGATGCGG + Intergenic
954784793 3:53084879-53084901 CATGCAGCTCCCTGGGGAAGGGG + Intronic
954943228 3:54393876-54393898 CACCCGTCTTCTTGGGGAGTGGG + Intronic
955356120 3:58234590-58234612 CATGCTTTTCCCTGGGGAGATGG + Intergenic
967210297 3:187162376-187162398 GATCCCTCTCCCTGGGGGTGGGG - Intronic
968046753 3:195628422-195628444 CATCCGGCACGCTGGGGCGGTGG - Intergenic
968551612 4:1226333-1226355 CATCCGTCTCCCTGGGGAGGAGG + Intronic
969216176 4:5724122-5724144 CATCTGTCAGCTTGGGGAGGTGG - Intronic
971200959 4:24508759-24508781 CATGCGGCTACCTGGGGAGAAGG + Intergenic
972151857 4:36101238-36101260 CTTCAGTATCCATGGGGAGGTGG - Intronic
976346078 4:84003189-84003211 CATCGGTTGCCCTGGGGAGGAGG + Intergenic
976402104 4:84619092-84619114 AATCCCTCACCCTTGGGAGGCGG - Intronic
977691668 4:99918697-99918719 CTTACGTCTCCCTGGCTAGGAGG + Intronic
978928437 4:114280234-114280256 CATTTGTCTCCCTGAGGAAGAGG + Intergenic
981343149 4:143646026-143646048 CATCTCTCTCACTGGGGAAGGGG - Intronic
985100603 4:186454481-186454503 AATTCATCTCCCTGGGGAGTAGG + Intronic
985708263 5:1414038-1414060 CATGCGTCGGCCTGGGGAGCGGG + Intronic
985720841 5:1487935-1487957 GTTCTTTCTCCCTGGGGAGGGGG - Intronic
988455268 5:31381842-31381864 AATTTGTCTCCCTGGGGAGTGGG + Intergenic
989098319 5:37801336-37801358 CATCCGTCTTCTAGAGGAGGAGG + Intergenic
999531856 5:152472241-152472263 CATCAGGCTCTCTGGGGAGGTGG - Intergenic
1000049101 5:157546700-157546722 CATCAGTCTCCCCGGGGAGAGGG - Intronic
1001090960 5:168740648-168740670 AAACCGTCTTCCTGGGGTGGAGG - Intronic
1001286369 5:170426931-170426953 CTTCCCTCTCCCTGTGGAGCTGG - Intronic
1001286379 5:170426970-170426992 CTTCCCTCTCCCTGTGGAGCTGG - Intronic
1001461070 5:171914927-171914949 CAACCTTCTCCCTGAAGAGGAGG + Intronic
1002199008 5:177516638-177516660 CCTCGGCCTCCGTGGGGAGGAGG - Intronic
1002401435 5:178993599-178993621 CATCCGGCTCTCTGTGAAGGAGG - Intronic
1003515272 6:6812877-6812899 CATCTGTCACACTGAGGAGGTGG - Intergenic
1003757774 6:9141354-9141376 CATCAGTCTAGCTGGGGAGTTGG - Intergenic
1005264442 6:24096678-24096700 AATACGTCTACCTGAGGAGGTGG - Intergenic
1006398191 6:33800708-33800730 CAGCCTTCTCCCTGGAGATGGGG + Intronic
1006642231 6:35495468-35495490 CTACCCTCTCCCTGAGGAGGGGG + Intronic
1006843252 6:37045103-37045125 AAGCCGTTTCCCTGGGGAGATGG + Exonic
1013964048 6:115934488-115934510 CATCTGTGACCCTGGGAAGGAGG + Exonic
1015507067 6:133999694-133999716 CACATGTCTCCCTGGGCAGGAGG - Intronic
1016228383 6:141771404-141771426 CAGCAGTGTCCCAGGGGAGGTGG - Intergenic
1016293666 6:142551315-142551337 CATCTGTCTTCCTGAGGAGCAGG - Intergenic
1017024857 6:150172805-150172827 CATCTGGCCTCCTGGGGAGGAGG - Intronic
1018953702 6:168394376-168394398 AATCCGTCTACCTGGGTAGAAGG + Intergenic
1019638279 7:2088545-2088567 CATCCATCTCCCTGGGAGGCCGG + Intronic
1026429911 7:70335023-70335045 CATCTGTCTCCCTGATGAGAAGG - Intronic
1026873567 7:73867437-73867459 CATCTGTCTCCCTGGGGAAAGGG + Intergenic
1026898774 7:74025964-74025986 CCTCCGCCTGCCTGGGAAGGAGG - Intergenic
1029113248 7:98223975-98223997 CAGGGGTCTCCCTGGGGAAGGGG + Intronic
1029217970 7:98965493-98965515 CATCCCTCTCCCTGCAGAGAGGG + Intronic
1030295884 7:107926636-107926658 CATCATGCTCCTTGGGGAGGTGG - Intronic
1032039843 7:128550388-128550410 CATTCTTCTCCATGGAGAGGGGG + Intergenic
1032204300 7:129848339-129848361 CATCCCTCTCCCTCTGGAGGAGG + Intronic
1032421242 7:131781772-131781794 CACCAATCTCCCTGGGAAGGGGG - Intergenic
1033097389 7:138442752-138442774 TGTCCCTGTCCCTGGGGAGGAGG + Intergenic
1034415867 7:150963974-150963996 CAGCAGTCTACCTGGGGTGGGGG + Intronic
1035395401 7:158531542-158531564 CACCCGTCTGCCTCGTGAGGAGG - Intronic
1035752802 8:2008083-2008105 CATCTGACACCCTGGGGTGGGGG - Intergenic
1035752817 8:2008142-2008164 CATCTGACACCCTGGGGTGGGGG - Intergenic
1035752828 8:2008173-2008195 CATCTGACACCCTGGGGTGGGGG - Intergenic
1035753148 8:2009681-2009703 CATCTGACACCCTGGGGTGGGGG - Intergenic
1035753176 8:2009771-2009793 CATCTGACCCCCTGGGGTGGGGG - Intergenic
1036166128 8:6435388-6435410 AATCCGCCTCCCTGAGGTGGGGG + Intronic
1036547130 8:9782691-9782713 CCTCCGTCTCCCCCGAGAGGTGG - Intergenic
1036661390 8:10711265-10711287 AACCTGTCTTCCTGGGGAGGAGG - Intronic
1037512969 8:19602527-19602549 CACCGTTCTCCCTGGGGAGCGGG - Intronic
1038487630 8:27948240-27948262 CCGCCCTCACCCTGGGGAGGAGG - Intronic
1038916565 8:32031088-32031110 CAGCTGTCTCTTTGGGGAGGTGG + Intronic
1040076972 8:43246680-43246702 CTTCTGTCTCCCTGCGGCGGAGG + Intergenic
1040564683 8:48555114-48555136 CCTCCCTGTCCCTGGGGAGTGGG + Intergenic
1041044361 8:53877482-53877504 CGTTCGTCTCGCTCGGGAGGAGG - Intronic
1042349392 8:67761636-67761658 CCTCCGTCTCCCTGGGACAGAGG + Intergenic
1044318288 8:90774493-90774515 AATCCGTCTTCCAGGGGAGGTGG - Intronic
1045351590 8:101345701-101345723 CAAAAGTCTCCCTGGGGTGGGGG - Intergenic
1049086155 8:140480117-140480139 ACTCCCTTTCCCTGGGGAGGAGG - Intergenic
1049577817 8:143397789-143397811 CATCCTTCTGGCTGGGCAGGTGG + Intergenic
1051506302 9:17831131-17831153 CAGGCTTCTCCTTGGGGAGGGGG + Intergenic
1052998948 9:34566627-34566649 CATCCAGCTGCCTGAGGAGGAGG + Intronic
1053256923 9:36625505-36625527 CATGCCTATCCCTGGGAAGGAGG - Intronic
1053257276 9:36628294-36628316 CATGCCTATCCCTGGGAAGGAGG + Intronic
1056318443 9:85414364-85414386 CATTCCTCTCCCTCTGGAGGAGG - Intergenic
1059380473 9:113919638-113919660 CAGCCCTCTCCGTGAGGAGGTGG + Intronic
1060243122 9:121921842-121921864 CTTCCTTCTACCTGAGGAGGCGG - Intronic
1060488460 9:124064657-124064679 CATCCGTGTGCCTTGGCAGGGGG + Intergenic
1060846209 9:126839498-126839520 CATGCTTCTCCCCGGGGTGGAGG + Intergenic
1061312920 9:129775661-129775683 CAACCAGCACCCTGGGGAGGGGG + Intergenic
1061487645 9:130928490-130928512 CATCCCTCTACCCCGGGAGGGGG + Intronic
1062140024 9:134950942-134950964 CATCCGCCTCCCTGGGCGCGTGG + Intergenic
1185608404 X:1380392-1380414 CTTCTGTCTCCCGGGGGAAGGGG + Intronic
1190265742 X:48826530-48826552 CACCTGTGTCCGTGGGGAGGCGG - Intergenic
1199515886 X:148675051-148675073 CATGTGTCTCTTTGGGGAGGGGG + Intronic
1202596704 Y:26548092-26548114 CATACGTATCTCTGGGAAGGGGG + Intergenic