ID: 968551614

View in Genome Browser
Species Human (GRCh38)
Location 4:1226336-1226358
Sequence CCGTCTCCCTGGGGAGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968551605_968551614 -4 Left 968551605 4:1226317-1226339 CCTGTGTCCGACTGGCCATCCGT 0: 1
1: 0
2: 0
3: 2
4: 32
Right 968551614 4:1226336-1226358 CCGTCTCCCTGGGGAGGAGGAGG No data
968551600_968551614 17 Left 968551600 4:1226296-1226318 CCCCATCCGGATGATTGCATTCC 0: 1
1: 0
2: 4
3: 46
4: 187
Right 968551614 4:1226336-1226358 CCGTCTCCCTGGGGAGGAGGAGG No data
968551601_968551614 16 Left 968551601 4:1226297-1226319 CCCATCCGGATGATTGCATTCCT 0: 1
1: 0
2: 0
3: 5
4: 284
Right 968551614 4:1226336-1226358 CCGTCTCCCTGGGGAGGAGGAGG No data
968551602_968551614 15 Left 968551602 4:1226298-1226320 CCATCCGGATGATTGCATTCCTG 0: 1
1: 0
2: 0
3: 4
4: 105
Right 968551614 4:1226336-1226358 CCGTCTCCCTGGGGAGGAGGAGG No data
968551603_968551614 11 Left 968551603 4:1226302-1226324 CCGGATGATTGCATTCCTGTGTC 0: 1
1: 0
2: 2
3: 9
4: 144
Right 968551614 4:1226336-1226358 CCGTCTCCCTGGGGAGGAGGAGG No data
968551598_968551614 21 Left 968551598 4:1226292-1226314 CCCACCCCATCCGGATGATTGCA 0: 1
1: 0
2: 0
3: 5
4: 84
Right 968551614 4:1226336-1226358 CCGTCTCCCTGGGGAGGAGGAGG No data
968551599_968551614 20 Left 968551599 4:1226293-1226315 CCACCCCATCCGGATGATTGCAT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 968551614 4:1226336-1226358 CCGTCTCCCTGGGGAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968551614 Original CRISPR CCGTCTCCCTGGGGAGGAGG AGG Intronic
No off target data available for this crispr