ID: 968551616

View in Genome Browser
Species Human (GRCh38)
Location 4:1226338-1226360
Sequence GTCTCCCTGGGGAGGAGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1367
Summary {0: 1, 1: 0, 2: 9, 3: 84, 4: 1273}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968551598_968551616 23 Left 968551598 4:1226292-1226314 CCCACCCCATCCGGATGATTGCA 0: 1
1: 0
2: 0
3: 5
4: 84
Right 968551616 4:1226338-1226360 GTCTCCCTGGGGAGGAGGAGGGG 0: 1
1: 0
2: 9
3: 84
4: 1273
968551603_968551616 13 Left 968551603 4:1226302-1226324 CCGGATGATTGCATTCCTGTGTC 0: 1
1: 0
2: 2
3: 9
4: 144
Right 968551616 4:1226338-1226360 GTCTCCCTGGGGAGGAGGAGGGG 0: 1
1: 0
2: 9
3: 84
4: 1273
968551605_968551616 -2 Left 968551605 4:1226317-1226339 CCTGTGTCCGACTGGCCATCCGT 0: 1
1: 0
2: 0
3: 2
4: 32
Right 968551616 4:1226338-1226360 GTCTCCCTGGGGAGGAGGAGGGG 0: 1
1: 0
2: 9
3: 84
4: 1273
968551599_968551616 22 Left 968551599 4:1226293-1226315 CCACCCCATCCGGATGATTGCAT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 968551616 4:1226338-1226360 GTCTCCCTGGGGAGGAGGAGGGG 0: 1
1: 0
2: 9
3: 84
4: 1273
968551602_968551616 17 Left 968551602 4:1226298-1226320 CCATCCGGATGATTGCATTCCTG 0: 1
1: 0
2: 0
3: 4
4: 105
Right 968551616 4:1226338-1226360 GTCTCCCTGGGGAGGAGGAGGGG 0: 1
1: 0
2: 9
3: 84
4: 1273
968551600_968551616 19 Left 968551600 4:1226296-1226318 CCCCATCCGGATGATTGCATTCC 0: 1
1: 0
2: 4
3: 46
4: 187
Right 968551616 4:1226338-1226360 GTCTCCCTGGGGAGGAGGAGGGG 0: 1
1: 0
2: 9
3: 84
4: 1273
968551606_968551616 -9 Left 968551606 4:1226324-1226346 CCGACTGGCCATCCGTCTCCCTG 0: 1
1: 0
2: 1
3: 15
4: 166
Right 968551616 4:1226338-1226360 GTCTCCCTGGGGAGGAGGAGGGG 0: 1
1: 0
2: 9
3: 84
4: 1273
968551601_968551616 18 Left 968551601 4:1226297-1226319 CCCATCCGGATGATTGCATTCCT 0: 1
1: 0
2: 0
3: 5
4: 284
Right 968551616 4:1226338-1226360 GTCTCCCTGGGGAGGAGGAGGGG 0: 1
1: 0
2: 9
3: 84
4: 1273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968551616 Original CRISPR GTCTCCCTGGGGAGGAGGAG GGG Intronic
900136869 1:1121507-1121529 GCCTGGCTGGGGAGGAGGTGGGG - Intergenic
900188520 1:1343779-1343801 GTCTCCCTGGCTAGGTGGACAGG - Intronic
900214827 1:1475827-1475849 GTGACTCTGGGGAGGAGGAGAGG - Intronic
900222040 1:1514181-1514203 GTGACTCTGGGGAGGAGGAGAGG - Intronic
900506519 1:3032138-3032160 GGCACCCTGGGGAGGACGGGGGG + Intergenic
900544295 1:3219938-3219960 GTCTCCCTGGGGAGATGGCGAGG + Intronic
900772436 1:4555913-4555935 ATCTTCCTGGGGAAGAGAAGAGG + Intergenic
900863449 1:5250171-5250193 CTCTCCCTGGGGAGAATGAGAGG + Intergenic
901003013 1:6158151-6158173 GGCTCCTTGGGGAGATGGAGAGG - Intronic
901103692 1:6738742-6738764 TTGTCCCTGGGGAGAAGGACAGG - Intergenic
901260415 1:7866628-7866650 GGCTCCCAGGGAGGGAGGAGGGG - Intergenic
901592189 1:10353800-10353822 GTATGTCTGGGGAGGGGGAGTGG + Intronic
901628738 1:10638297-10638319 GTTTCCCTGGGGCGGAGGCTGGG + Exonic
901630759 1:10647084-10647106 GCTACTCTGGGGAGGAGGAGGGG + Intronic
902250753 1:15153217-15153239 GCCTCCCCAGGAAGGAGGAGAGG + Intronic
902368143 1:15990510-15990532 TTGGCCCTGGGGAGGAGGGGTGG - Intergenic
902488639 1:16764610-16764632 GCCTCTTTGGGGAGCAGGAGGGG - Intronic
902985549 1:20152218-20152240 GTCTCCCTGGCGTGGAGAGGAGG + Intergenic
903172773 1:21564024-21564046 ATTTCCCTGGGGTGCAGGAGGGG - Exonic
903540347 1:24093103-24093125 GGCTCCCTGTGGAGGGGAAGTGG + Exonic
904427588 1:30439049-30439071 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
904466589 1:30711715-30711737 GTGTCCCCAAGGAGGAGGAGAGG - Exonic
904619396 1:31766297-31766319 GCCTCCTGGGGAAGGAGGAGGGG - Intergenic
904898364 1:33835912-33835934 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
905028295 1:34865797-34865819 GTGCCCATGGGGAGGAGGTGGGG + Exonic
905150567 1:35923681-35923703 TTCTCCCTGGGCAGGGAGAGAGG + Exonic
905322858 1:37130177-37130199 GTCTGCCTGGGGTGGGGGAAGGG - Intergenic
905341028 1:37277568-37277590 GTCTCCATGTGGAGGGGCAGGGG + Intergenic
905404978 1:37726492-37726514 GTGGCCCTGGGGAGAAGGGGAGG + Intronic
905751374 1:40467589-40467611 GTCTCCTTTGGGATGAGGAAAGG - Intergenic
905840932 1:41177332-41177354 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
905865883 1:41376432-41376454 GTCTCTCTGGGGAGCAGGGTGGG + Intronic
905981636 1:42234449-42234471 GTGTTCCTCTGGAGGAGGAGAGG + Intronic
906153970 1:43603398-43603420 GTTTCCTGAGGGAGGAGGAGGGG - Exonic
906363139 1:45181026-45181048 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
906738015 1:48151081-48151103 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
906762383 1:48387661-48387683 GTCTGGCATGGGAGGAGGAGGGG - Intronic
906878699 1:49566349-49566371 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
907118393 1:51989538-51989560 GTCAGCCTGGGGAGGAGGCCAGG - Intronic
907175602 1:52519346-52519368 TTGTCAGTGGGGAGGAGGAGCGG + Intronic
907277871 1:53327071-53327093 GACCCGCTGGGGAGGAGGAAAGG + Intronic
907631872 1:56090601-56090623 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
907852935 1:58274059-58274081 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
907876141 1:58490034-58490056 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
907927349 1:58966920-58966942 CTCACCCTAGAGAGGAGGAGAGG - Intergenic
908086548 1:60640966-60640988 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
908372882 1:63501440-63501462 GTTTCCAGGGGGAGGGGGAGAGG + Intronic
908401796 1:63778407-63778429 GTCTTCCTGGGGAGGCTGAAAGG + Intronic
908765290 1:67549261-67549283 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
908876761 1:68686546-68686568 GTGTTCCTGTGGAGGAGGAGAGG + Intergenic
908894229 1:68880830-68880852 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
909325986 1:74352017-74352039 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
909778729 1:79516305-79516327 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
909812090 1:79943443-79943465 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
909826847 1:80137599-80137621 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
909982264 1:82116780-82116802 GCCTCCCAGGGGAGGTGCAGGGG + Intergenic
910067282 1:83168510-83168532 GCATTCCTTGGGAGGAGGAGAGG - Intergenic
910328381 1:86038768-86038790 GTCTCCATGGGGAGGAAGTGAGG + Intronic
910381235 1:86629389-86629411 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
910714728 1:90218873-90218895 GCCTTCCTTTGGAGGAGGAGAGG + Intergenic
910807282 1:91201263-91201285 TCCTGTCTGGGGAGGAGGAGGGG + Intergenic
910939205 1:92515039-92515061 CTCCCCCTGGGGAGAAGGTGAGG + Intronic
911033132 1:93510550-93510572 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
911124336 1:94326569-94326591 CTCTGCCTGAGGAGGTGGAGTGG - Intergenic
911290958 1:96056627-96056649 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
911673841 1:100637286-100637308 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
911689912 1:100821023-100821045 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
911867777 1:103050650-103050672 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
911954943 1:104222116-104222138 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
912110099 1:106330482-106330504 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
912959969 1:114187676-114187698 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
913040588 1:115019078-115019100 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
913611921 1:120516985-120517007 GTGTCCCTGATGAGGATGAGGGG - Intergenic
914225145 1:145713913-145713935 GTCTCCCTTAGGAGGAGGCCTGG + Intergenic
914408714 1:147403468-147403490 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
914410705 1:147424170-147424192 GCGTCCCTTTGGAGGAGGAGAGG - Intergenic
914579270 1:149005254-149005276 GTGTCCCTGATGAGGATGAGGGG + Exonic
915076042 1:153308715-153308737 GGTGACCTGGGGAGGAGGAGAGG - Intronic
915106786 1:153539840-153539862 GTCTCACTGAGAAGGAGGAAGGG - Intronic
915108414 1:153548301-153548323 GCCTCCCCCCGGAGGAGGAGGGG + Intronic
915440228 1:155941353-155941375 CTCTCCCTGGGGTGGAGGCTTGG + Intergenic
915530140 1:156498605-156498627 GTCTCTCTGGGGGGAAGGGGGGG - Intronic
915590929 1:156869857-156869879 CTCCACCTGGGCAGGAGGAGTGG + Intronic
915727716 1:158030472-158030494 GGCTCCCTGGGGAGCAGGTTCGG - Intronic
915753723 1:158237590-158237612 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
915861942 1:159453907-159453929 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
915869169 1:159539291-159539313 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
916342771 1:163755288-163755310 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
916381526 1:164217112-164217134 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
916467461 1:165086043-165086065 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
916499455 1:165374492-165374514 GTCCACCTGGGAGGGAGGAGTGG + Intergenic
916658745 1:166901455-166901477 GTCTGCCTGGAGAGCAGGTGAGG + Intergenic
917161027 1:172056786-172056808 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
917175583 1:172231536-172231558 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
917316097 1:173726840-173726862 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
917575082 1:176313429-176313451 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
917666239 1:177228552-177228574 GGCTCCCTGGGGATGAGGCAAGG - Intronic
917710163 1:177676849-177676871 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
918351386 1:183659149-183659171 GTATTCCTTTGGAGGAGGAGAGG - Intronic
918397991 1:184135617-184135639 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
918563000 1:185892360-185892382 GCCTTCCTTTGGAGGAGGAGAGG + Intronic
918836556 1:189473789-189473811 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
919423291 1:197398768-197398790 GTATCCCAGGGAAGGAGTAGAGG + Intronic
919440214 1:197624609-197624631 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
919747209 1:201016469-201016491 GCTGCCATGGGGAGGAGGAGAGG - Intronic
919883228 1:201914726-201914748 GTGAGCCTGGGCAGGAGGAGAGG - Intronic
919935463 1:202247928-202247950 GAGGCGCTGGGGAGGAGGAGGGG - Intronic
920120170 1:203650384-203650406 GGGTCCCTGGGGAGGGAGAGAGG + Intronic
920268212 1:204742897-204742919 TTCTCCATGGGGAGGAAGACTGG + Intergenic
920543952 1:206800338-206800360 GTCTCCCTGGGGCAGGGCAGTGG + Intronic
920649158 1:207823805-207823827 GTTCCCGTGGGGAGGAGGTGGGG - Intergenic
921288379 1:213630628-213630650 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
921992991 1:221388111-221388133 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
922124775 1:222711976-222711998 CTGTCCCTGCGGAGGCGGAGAGG + Intronic
922160695 1:223077600-223077622 CTCTCCCTGTGGACGTGGAGTGG - Intergenic
922356451 1:224780871-224780893 CTCTCCCTGGAGGGGAGGATGGG + Intergenic
922802071 1:228368969-228368991 GCCTCCCCGGGGCAGAGGAGAGG - Intronic
923447923 1:234089710-234089732 AGCTCACTGGGTAGGAGGAGAGG + Intronic
923531801 1:234817907-234817929 GCCTCTTTGGGGAGCAGGAGGGG + Intergenic
923599130 1:235386848-235386870 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
923829339 1:237537891-237537913 TTCTCTCTGGGGATAAGGAGGGG + Intronic
924165855 1:241282142-241282164 GACTCCTAGGGGAGGAGGATGGG - Intronic
924616331 1:245614734-245614756 GTCTCACTGGAGAGGAGCCGAGG + Intronic
924872969 1:248068571-248068593 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1062924318 10:1302970-1302992 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1063336884 10:5223767-5223789 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1063583962 10:7334277-7334299 GTGTCACTGGGAAGGTGGAGGGG - Intronic
1063608175 10:7541253-7541275 GTCTCCCAGGAGGGGAGGATGGG + Intergenic
1063663347 10:8048450-8048472 GGCCCCCTGGGACGGAGGAGAGG + Intergenic
1064570047 10:16683250-16683272 GTCTCCCTGTGAAGGTGTAGAGG + Intronic
1064761775 10:18628347-18628369 GTATTCCTTTGGAGGAGGAGAGG - Intronic
1064794261 10:18993533-18993555 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1064840488 10:19586275-19586297 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1065049773 10:21779687-21779709 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1065594880 10:27300321-27300343 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1066503006 10:36013165-36013187 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1066813501 10:39372164-39372186 GTGTCCCTTTGGAGGAGGAGAGG + Intergenic
1066930332 10:41750287-41750309 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1067149452 10:43717777-43717799 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1067181690 10:43992092-43992114 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1067333483 10:45342557-45342579 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1067444013 10:46329375-46329397 GGCTGCCTGGAGAGGAAGAGGGG + Intronic
1068179129 10:53499053-53499075 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1068309269 10:55257315-55257337 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1068394788 10:56447131-56447153 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1068512543 10:57984605-57984627 GGCAGCCTGGGGAGGGGGAGTGG - Intergenic
1068568857 10:58606406-58606428 TTTTCCCTGGGGTGGGGGAGGGG + Intronic
1069264762 10:66443766-66443788 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1069325977 10:67231617-67231639 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1069338995 10:67388002-67388024 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1069353752 10:67559582-67559604 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1069547473 10:69339018-69339040 GTCTCCCTGGGAAAGAGGCTGGG - Intronic
1069568286 10:69478268-69478290 GTTTCTCTGGGCAGGAGGAGGGG + Intronic
1070352810 10:75609848-75609870 GTCTCCCTAGTGAGAAGAAGAGG + Intronic
1070474071 10:76815054-76815076 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1071999095 10:91176955-91176977 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1072055473 10:91750572-91750594 GCCTTCCTTTGGAGGAGGAGAGG - Intergenic
1072203507 10:93181682-93181704 TTCTCTTTGGGGAGGAGGGGAGG + Intergenic
1072384412 10:94909571-94909593 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1072388685 10:94959678-94959700 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1072405529 10:95148454-95148476 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1072531627 10:96324794-96324816 GTCTCCCTGGGTAAGAGTTGTGG + Intronic
1072619753 10:97072038-97072060 GTATGACTGGGGAGGAGCAGAGG + Intronic
1072741751 10:97914100-97914122 GAGTTCCTGGGGAGGAGGCGAGG + Intronic
1073481284 10:103787606-103787628 GTCTCCCTGGGGAGCAAGGCAGG + Intronic
1073688292 10:105780574-105780596 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1074639756 10:115367568-115367590 GCGTCCCTTTGGAGGAGGAGAGG + Intronic
1074945778 10:118279214-118279236 CCCTCCCTGGGGAGGGAGAGAGG - Intergenic
1075069868 10:119313718-119313740 GTGACCCAGGGGAGGTGGAGAGG - Intronic
1075395129 10:122121505-122121527 CTCTCCAGGGGGAGGAGGAATGG + Intronic
1075640134 10:124058642-124058664 GTCTCCCTTGTAAGGAGGCGAGG + Intronic
1076298320 10:129404452-129404474 GACTCCGTGGGGAGGGGGAAGGG + Intergenic
1076754941 10:132564484-132564506 GTGACTCTGAGGAGGAGGAGGGG - Intronic
1077081336 11:725963-725985 GGCTCCCTGGGCAGAAGGAAAGG + Intronic
1077187733 11:1242994-1243016 CTGTTCCTGGGGTGGAGGAGGGG - Exonic
1077188156 11:1244665-1244687 CTGTTCCTGGGGTGGAGGAGGGG - Exonic
1077188689 11:1246765-1246787 CTGTTCCTGGGGTGGAGGAGGGG - Exonic
1077189674 11:1250620-1250642 CTGTTCCTGGGGTGGAGGAGGGG - Exonic
1077192426 11:1260986-1261008 GTCCCCCTGGGGAGGGTGGGTGG + Intronic
1077328010 11:1971977-1971999 TTCTCACTGCGAAGGAGGAGAGG - Intronic
1077477573 11:2797671-2797693 GGGGCCCGGGGGAGGAGGAGGGG - Intronic
1077497321 11:2892500-2892522 GTCTCCAGGGGGTGGGGGAGGGG + Intronic
1077697260 11:4405841-4405863 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1077946534 11:6905665-6905687 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1077992399 11:7423740-7423762 GGCTCACTGGGGTGCAGGAGTGG - Intronic
1078111529 11:8397554-8397576 GTATTCCTTTGGAGGAGGAGAGG - Intronic
1079037455 11:17033551-17033573 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1079106875 11:17577448-17577470 GGCTTCCTGGGGTGGAGGAAGGG + Intronic
1079347462 11:19665439-19665461 GCTGCCATGGGGAGGAGGAGAGG - Intronic
1079353839 11:19714210-19714232 ATCTTCCTGGGGAGGAGGAAAGG + Intronic
1079361800 11:19776436-19776458 GGCCCTCTGGAGAGGAGGAGAGG - Intronic
1079629059 11:22651968-22651990 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1079660637 11:23033167-23033189 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1080893209 11:36427382-36427404 TTCTGCCTGGGGAGGTGGTGGGG + Intronic
1081086894 11:38812272-38812294 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1081161594 11:39756117-39756139 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1081382563 11:42434313-42434335 GCCTTCCTTTGGAGGAGGAGAGG + Intergenic
1081468830 11:43351140-43351162 GCCTTCCTTTGGAGGAGGAGAGG + Intergenic
1081617244 11:44598125-44598147 GTCTCACTGGGAGAGAGGAGAGG + Intronic
1081656833 11:44862879-44862901 ATGGCCCTGGGGAGGAGGAAGGG + Intronic
1081818906 11:45971911-45971933 GTCACCCTGGAGAGAAGGAAGGG + Intronic
1082141674 11:48616805-48616827 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1082253367 11:50006035-50006057 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1082578572 11:54838941-54838963 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1082579740 11:54850896-54850918 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1082623994 11:55460870-55460892 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1082634356 11:55578241-55578263 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1082970608 11:59016320-59016342 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1083009811 11:59386697-59386719 GTCTTCCTTTGGAGGAGGAGAGG + Intergenic
1083122917 11:60533114-60533136 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1083291807 11:61694699-61694721 GGCTCCGTGGGGAGGAAGGGTGG + Intronic
1083291924 11:61695293-61695315 GTCTGCCTGGGGCTGAGCAGTGG + Intronic
1083309083 11:61775379-61775401 GTCTGCCTGGAGAGGAGGGATGG - Intronic
1083327159 11:61878629-61878651 GAAGCCCTGTGGAGGAGGAGGGG + Exonic
1083420776 11:62551823-62551845 GCCTCCCTGGGGAGTGGGGGAGG + Intronic
1083454851 11:62771718-62771740 GTCACGCTGGAGAGGAGGCGTGG - Intronic
1083532458 11:63436251-63436273 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1083633578 11:64108417-64108439 GGCTTCCTGGCGAGAAGGAGGGG + Intronic
1083668194 11:64286359-64286381 GTCTCTCTGTTGAGGAGGAGGGG + Intronic
1083731873 11:64656678-64656700 CCCTCCCTGGAGGGGAGGAGAGG - Intronic
1083738771 11:64696732-64696754 GCGTCCCTGGGGAGGAGGAGAGG - Intronic
1083882414 11:65555131-65555153 GTGGCCCTAGGGAGGAGGGGAGG - Intronic
1084266939 11:68010026-68010048 GCCAGCCTGAGGAGGAGGAGTGG - Intronic
1084288802 11:68148545-68148567 GACTGCCTTGGAAGGAGGAGAGG + Intergenic
1084374944 11:68770147-68770169 CTCTCCCTGGGGAGGAGTTGGGG + Intronic
1084411332 11:69007834-69007856 GGGTCCCTGGGGTGGAGGAGAGG + Intronic
1084560304 11:69901520-69901542 ATTTCCCTGGGAAGGGGGAGTGG - Intergenic
1084642759 11:70435614-70435636 GTCTCACTGCTGGGGAGGAGAGG + Exonic
1085133311 11:74060709-74060731 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1085253783 11:75160534-75160556 GGCTCCCAGAGGAGGTGGAGGGG - Intronic
1085274899 11:75292084-75292106 GGCTCCCAGGGGAGGTGGGGCGG - Intronic
1085519738 11:77130943-77130965 AGGTCCCTGGGGAAGAGGAGAGG + Intronic
1086290213 11:85300392-85300414 GTATCCCTGAGGAGTTGGAGGGG - Intronic
1086301083 11:85426719-85426741 GTATTCCTTTGGAGGAGGAGAGG - Intronic
1086379741 11:86239938-86239960 GGCTGCCTGGGGAGAAAGAGAGG + Intergenic
1086771709 11:90775048-90775070 AGCTCCCTGGGCAGGAGAAGTGG - Intergenic
1087073430 11:94104841-94104863 GTGCCCCTGGGAAGGAGGAAAGG - Intronic
1087545837 11:99582873-99582895 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1087631299 11:100653450-100653472 GTATTCCTTTGGAGGAGGAGAGG - Intergenic
1087722549 11:101683450-101683472 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1087737782 11:101853568-101853590 GTATTCCTTTGGAGGAGGAGAGG - Intronic
1088731034 11:112683597-112683619 GTGTTCCTTTGGAGGAGGAGGGG + Intergenic
1088771623 11:113041773-113041795 GTCACCCATGGGAGGAGCAGTGG - Intronic
1089079990 11:115767596-115767618 GGGTCCCAGGGGAGGTGGAGAGG - Intergenic
1089215142 11:116830496-116830518 CCCTCCCTGGGGAGGTGGCGTGG - Intronic
1089216312 11:116836713-116836735 GTCTTGCTGGGCAGGAGCAGAGG + Intronic
1089292736 11:117448099-117448121 GTCTCCATCAGCAGGAGGAGGGG + Intronic
1089298077 11:117481559-117481581 GGGTCCCAGGGGAGTAGGAGGGG + Intronic
1089498416 11:118919213-118919235 GGCCCCACGGGGAGGAGGAGAGG + Intronic
1089561826 11:119347028-119347050 GTCACCCTGGTGGGGAGGAAAGG - Intergenic
1089623563 11:119737042-119737064 GTTTACCTGGGGCTGAGGAGGGG + Intergenic
1089888590 11:121855976-121855998 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1090086393 11:123654403-123654425 GGCTCCCTGGGGAGGTGCAGCGG + Exonic
1090709268 11:129371588-129371610 TGCACCCTGGGGTGGAGGAGTGG - Intergenic
1090896910 11:130985219-130985241 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1091279588 11:134374389-134374411 GCCTCCCTGGGCCAGAGGAGTGG + Intronic
1202810989 11_KI270721v1_random:27157-27179 TTCTCACTGCGAAGGAGGAGAGG - Intergenic
1091750476 12:3018844-3018866 GTCCCCCAGGGGAGGAGGCTGGG + Intronic
1091843212 12:3635108-3635130 CTCTGCCTGGGGAGGGGCAGTGG - Intronic
1092385593 12:8033560-8033582 GTTACCCGGGGGAGGAGGGGAGG - Exonic
1093297569 12:17410145-17410167 GTCTCCGTGGGGTGGGGGTGGGG + Intergenic
1093314130 12:17627576-17627598 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1093404363 12:18786297-18786319 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1093477709 12:19573869-19573891 GTTTCCCTGGAGAGGGGGGGCGG - Intronic
1093641324 12:21529633-21529655 GTGTCACTGGGCAGGAGGTGGGG - Intronic
1094710528 12:32957261-32957283 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1094728386 12:33146825-33146847 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1095089733 12:38092409-38092431 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1095165599 12:38968511-38968533 GCCTTCCTTTGGAGGAGGAGAGG + Intergenic
1095385198 12:41642464-41642486 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1095911216 12:47427855-47427877 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1095940911 12:47726181-47726203 GGCTCCCAGGGGAAGAAGAGTGG - Intergenic
1095969667 12:47892868-47892890 GTCTCCGTGGAGAGGTTGAGAGG - Intronic
1095985023 12:47993735-47993757 GTCTCCCTGGCTAGGAAGAGGGG + Intronic
1096030251 12:48408219-48408241 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1096433714 12:51570694-51570716 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1096610839 12:52800453-52800475 TCCTGCCTGGGGAGGAGGAATGG + Intergenic
1096693248 12:53333766-53333788 GGCTTCCTGGGGAGGTGGGGAGG + Intronic
1096785009 12:54011944-54011966 GGAGCCCTGGGGAGGGGGAGGGG - Exonic
1096902739 12:54901490-54901512 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1096921028 12:55086416-55086438 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1096952210 12:55484964-55484986 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1097222997 12:57461451-57461473 GTGTGTATGGGGAGGAGGAGGGG - Intronic
1097304923 12:58058719-58058741 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1097321540 12:58231989-58232011 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1097567988 12:61294852-61294874 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1097712846 12:62934525-62934547 GTCTCCTTGAGGATGAGGATGGG + Exonic
1098294718 12:68992119-68992141 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1098388081 12:69939635-69939657 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1098464054 12:70766106-70766128 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1098586015 12:72155441-72155463 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1098683979 12:73395763-73395785 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1098876461 12:75870926-75870948 ATCTGGCTGGGGAGGAAGAGAGG - Intergenic
1098962649 12:76754996-76755018 GTCTCAGTTGGCAGGAGGAGAGG + Intergenic
1099114702 12:78609560-78609582 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1099193366 12:79583931-79583953 GTCTGCCTGGTGAAGGGGAGAGG - Intronic
1099240038 12:80128089-80128111 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1100624521 12:96316899-96316921 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1100663750 12:96728726-96728748 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1100720624 12:97354457-97354479 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1100921820 12:99497068-99497090 GACTCCCTGTTGAGGAGGATTGG + Intronic
1100938935 12:99703632-99703654 CTCTCCCAGGGGAGGAGAACAGG - Intronic
1102002618 12:109566801-109566823 GTCTCTCAGTTGAGGAGGAGCGG - Intronic
1102255149 12:111410718-111410740 GGGTCCCTGGGGAGGCAGAGAGG - Intronic
1102393404 12:112567826-112567848 GTCTCCCTGGAGAGGACCAAAGG + Intergenic
1102768071 12:115450750-115450772 CTCTGCCTGGTGATGAGGAGTGG + Intergenic
1102853993 12:116277628-116277650 GGCTGACTGGGGAGGAGGGGGGG - Intergenic
1102856945 12:116302447-116302469 GTGTGCGTGGGGAGGTGGAGAGG + Intergenic
1103216434 12:119205186-119205208 ATCTCCCTGGGGTGGAAGTGCGG + Intronic
1103467822 12:121156062-121156084 GTTCCCCTGTGGAGAAGGAGAGG - Exonic
1103506378 12:121444326-121444348 GTCGGCCTGGGGAGGAGGAAGGG - Intronic
1104308069 12:127627823-127627845 GTGTACCTGAGGAGGAGGGGAGG - Intergenic
1104333204 12:127866810-127866832 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1104641216 12:130468562-130468584 ATTCCCCTGGGGTGGAGGAGAGG - Intronic
1104783880 12:131437632-131437654 ATCTCCCTGGGAAGGATCAGTGG + Intergenic
1104986492 12:132600510-132600532 GTGTCCCTGAGGAGCAGGGGCGG + Intergenic
1105474850 13:20720877-20720899 GTCTGCCGGGGGAGGGGGGGGGG - Intronic
1105552359 13:21409939-21409961 GTGACCCTTTGGAGGAGGAGAGG + Intronic
1105598261 13:21860803-21860825 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1107154881 13:37155007-37155029 GCCTTCCTTTGGAGGAGGAGAGG + Intergenic
1107245517 13:38289237-38289259 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1107810868 13:44198703-44198725 GTCTCCATGAGGAGGAGGAAAGG - Intergenic
1108174987 13:47782842-47782864 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1108184751 13:47877352-47877374 GTTTCCCTGAGGAGGGGGATTGG - Intergenic
1108200413 13:48037831-48037853 GTCCTCCTGGGGAAGAGGAAAGG + Exonic
1108241264 13:48466500-48466522 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1109197146 13:59390686-59390708 GGCTGCGTGGGGAGGAGGTGAGG - Intergenic
1109342505 13:61079104-61079126 GTCTCCTTGGCCAAGAGGAGGGG - Intergenic
1110919742 13:81069137-81069159 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1110991354 13:82046306-82046328 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1111219851 13:85189846-85189868 GTTTCACTGGAGAGCAGGAGGGG + Intergenic
1111322637 13:86650657-86650679 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1112370471 13:98788769-98788791 GCCTCACTGGGGAGGGGGAATGG - Intergenic
1112583850 13:100699049-100699071 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1113082479 13:106534214-106534236 GTCTCCCCGGCGCGGAGGAAAGG + Intronic
1113102271 13:106733553-106733575 ATCTTCCTGGGGAGGTGGAGAGG - Intergenic
1113107028 13:106783297-106783319 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1113711333 13:112467275-112467297 GGCTCCTGGGGGAGGAGGTGCGG - Intergenic
1113769117 13:112897396-112897418 GCATGGCTGGGGAGGAGGAGTGG - Intronic
1113777652 13:112957526-112957548 GTCTATCTGGCGAGGAGGCGCGG - Intronic
1113881313 13:113628423-113628445 CTCTCGCTGGGGAGCAGGGGAGG - Intronic
1113900278 13:113793106-113793128 CTCTGCCTGGGGAGGTGGAGGGG + Intronic
1114141086 14:19911556-19911578 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1114212627 14:20628223-20628245 GCCTGACTGGGGAGGAGGAGTGG - Intergenic
1114401463 14:22414671-22414693 GTCTCCCATTGGAGGTGGAGTGG + Intergenic
1114484396 14:23054409-23054431 ATCTGGCTGGGGAGGAGGCGAGG + Intronic
1114691477 14:24586735-24586757 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1114716652 14:24833298-24833320 GTTTCCCTGAGGTGGAAGAGAGG + Intronic
1115044547 14:28975283-28975305 TACTCCCTGAGGAGGACGAGAGG + Intergenic
1115072102 14:29336270-29336292 GTTTCATTGGGAAGGAGGAGAGG + Intergenic
1115238296 14:31229729-31229751 GTAACACTGGGGAGGAGCAGAGG - Intergenic
1115832264 14:37355956-37355978 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1116011600 14:39358601-39358623 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1116398510 14:44476212-44476234 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1116704935 14:48284755-48284777 GCATTCCTGTGGAGGAGGAGAGG + Intergenic
1117104647 14:52385254-52385276 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1117252654 14:53952224-53952246 GTGTCTCTGGGGAGGGGGAGGGG + Exonic
1117468520 14:56019066-56019088 GCCTTCCTTTGGAGGAGGAGAGG + Intergenic
1117797673 14:59410528-59410550 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1118005602 14:61562158-61562180 CCCTCCCTGGAGAGGAGGTGGGG - Intronic
1118446845 14:65859907-65859929 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1118837668 14:69488036-69488058 CTGCCCCTGGGGAGGAGAAGGGG - Intronic
1119004242 14:70908698-70908720 GCCTCCCTGGGGGGAGGGAGCGG + Intronic
1119111693 14:71981311-71981333 GCTTCCCTTTGGAGGAGGAGAGG + Intronic
1119724357 14:76913332-76913354 GTGTCCCCGGGGTGGGGGAGTGG + Intergenic
1119734782 14:76974968-76974990 GTCTCCCTCTGGAGGTGCAGGGG - Intergenic
1119777164 14:77256570-77256592 GCCTGGCTGGGGAGGAGGCGGGG - Exonic
1120709661 14:87780501-87780523 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1121512303 14:94521561-94521583 GTCTTCCTGGGCGGGAGCAGTGG - Intergenic
1121790742 14:96697790-96697812 GTGTCCCTGTGGAAAAGGAGAGG + Intergenic
1122092110 14:99347700-99347722 GGCTGCCTGGGGATGGGGAGGGG - Intergenic
1122275974 14:100590982-100591004 GTCTCCATGGGAAGCAGCAGTGG + Intergenic
1122322898 14:100866301-100866323 GTCTCCATGGGGTGGGGGCGGGG - Intergenic
1123012746 14:105357228-105357250 CTCTCCCCGGGGATCAGGAGGGG - Intronic
1202906009 14_GL000194v1_random:72878-72900 ATCTCCCTTCCGAGGAGGAGCGG + Intergenic
1124373277 15:29115395-29115417 GTCTGGCTCAGGAGGAGGAGGGG + Intronic
1125218635 15:37308326-37308348 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1125482905 15:40092838-40092860 GTCTGCCAGGGCAGGAGGACTGG + Intronic
1125587471 15:40831018-40831040 CTCTTCCTGAGCAGGAGGAGGGG + Intergenic
1125879123 15:43176779-43176801 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1125904272 15:43376113-43376135 GTCTCACTGGGGTGGAGGAAAGG - Exonic
1125937768 15:43650913-43650935 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1125974668 15:43940334-43940356 GTCTCCCTGGGCGGGAAGAATGG - Intronic
1126005558 15:44252978-44253000 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1126122919 15:45269486-45269508 GTCTCTCTGGAATGGAGGAGTGG + Exonic
1126574462 15:50183483-50183505 TTCTCCCTGGGGATCAGGTGGGG - Intronic
1126889077 15:53184316-53184338 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1127189497 15:56514967-56514989 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1127527161 15:59804426-59804448 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1127978656 15:64017848-64017870 GACTCCCGGAGAAGGAGGAGAGG + Intronic
1127985852 15:64069842-64069864 GACTCCCTTTGGAGGAGGAAGGG - Intronic
1128151857 15:65368274-65368296 TTCTCCCTGGGGGTGGGGAGGGG + Intronic
1128259170 15:66220460-66220482 GGTTGCCAGGGGAGGAGGAGAGG + Intronic
1128309283 15:66620469-66620491 TTCTGCCTGGGGAGGAGGAGGGG + Intronic
1128311096 15:66632161-66632183 GTCTCCCTGGGCAGGAAGCCAGG - Intronic
1128334187 15:66775607-66775629 GGTTCCAGGGGGAGGAGGAGAGG - Intronic
1128371403 15:67042236-67042258 TTCTACCTGAGGAGGGGGAGGGG + Intergenic
1128372119 15:67048097-67048119 GTCTAGCTGGGGATGAGAAGAGG - Intergenic
1128385085 15:67141885-67141907 GTTTGCCTGGGGATGAGGTGGGG + Intronic
1129172601 15:73817294-73817316 GTCCCTGTGGGGAGGAGGTGCGG - Intergenic
1129603458 15:77013399-77013421 GTCTCCATGGGGGGGTGGTGGGG + Intronic
1129761604 15:78131847-78131869 GTCCCTCTGGGGAGAAGGAGGGG + Intronic
1129823103 15:78617848-78617870 GCCTCCCTGGGGAGGACATGTGG + Intronic
1129845989 15:78767959-78767981 GAGGCCCTGGGGAGGAGCAGAGG - Intronic
1130275587 15:82474671-82474693 GTCTCCCTGAGCAGGATGGGTGG + Intergenic
1130304165 15:82701841-82701863 ATCTCCCAGGGCAGGAGGTGGGG + Intronic
1130432445 15:83861713-83861735 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1130597244 15:85256549-85256571 ACCTCCCTGGGGAGGAAGAGCGG + Intergenic
1130599074 15:85264082-85264104 GAGGCCCTGGGGAGGAGCAGAGG - Intergenic
1130667738 15:85884085-85884107 GAGTGCCTGGGAAGGAGGAGGGG + Intergenic
1130806804 15:87332445-87332467 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1131166107 15:90143334-90143356 GTCTACCTGGGGAGGGGCAGTGG + Intergenic
1132218409 15:100084935-100084957 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1132595289 16:746347-746369 GTCTGGCTGGGCAGCAGGAGGGG + Intronic
1132595311 16:746434-746456 GTCTGGCTGGGCAGCAGGAGAGG + Intronic
1132595342 16:746566-746588 GTCTGGCTGGGCAGCAGGAGAGG + Intronic
1132595353 16:746610-746632 GTCTGGCTGGGCAGCAGGAGGGG + Intronic
1132595366 16:746656-746678 GTCTGGCTGGGCAGCAGGAGGGG + Intronic
1132992639 16:2804897-2804919 GTCACCCTGGGGAGCAGCATGGG - Intergenic
1133765822 16:8837049-8837071 CTCAGCCTGGCGAGGAGGAGAGG + Intronic
1133982048 16:10640147-10640169 GTCACACGGAGGAGGAGGAGGGG - Intronic
1134184624 16:12075213-12075235 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1134638701 16:15811941-15811963 GGGTCCCTGGGGTGTAGGAGGGG - Intronic
1136188320 16:28600969-28600991 TTCTCCCTGGGGAGGAGAACGGG + Intergenic
1136190792 16:28613963-28613985 TTCTCCCTGGGGAGGAGAACGGG + Intronic
1136432897 16:30206102-30206124 ATCTCCATGGGGAGGAGAACAGG - Exonic
1136498669 16:30659131-30659153 GTCTCCCCGAGGAAGAGGAAGGG - Exonic
1136606678 16:31338963-31338985 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1136908802 16:34129181-34129203 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1136992006 16:35158465-35158487 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1136992324 16:35161109-35161131 GTGTACCTTTGGAGGAGGAGAGG - Intergenic
1137493147 16:48949834-48949856 CTCTCCCTGGGGAGGAATGGAGG - Intergenic
1137569662 16:49557336-49557358 GCCAACCCGGGGAGGAGGAGCGG - Intronic
1137669242 16:50269738-50269760 CTCTCCCTGGGCAGTGGGAGAGG - Intronic
1138315556 16:56066790-56066812 GTATCCCTGGGGCAGTGGAGAGG - Intergenic
1138594537 16:58022778-58022800 GTCTCGCTGAGGGGGAGGGGTGG + Intergenic
1138680153 16:58678354-58678376 ATCTCCCTGGGGATGGAGAGGGG + Exonic
1138720467 16:59073331-59073353 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1139376057 16:66497060-66497082 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1139966725 16:70749868-70749890 CTCTGCCTGGGGTGGAAGAGAGG + Intronic
1140179000 16:72695432-72695454 GCCTTCCTTTGGAGGAGGAGAGG + Intergenic
1140469617 16:75206819-75206841 GGCTCTCAGGGGAGGAGGCGGGG - Intronic
1140506765 16:75478504-75478526 GCCTACTTGGGGAGGGGGAGGGG + Exonic
1141135772 16:81464194-81464216 GTCTCCCAGGGGAAGTGGCGTGG + Intronic
1141292154 16:82728338-82728360 GTGTCGCTGGGGAGGAAAAGTGG - Intronic
1141530517 16:84643414-84643436 GTCTCCTGGGGGAGGAGGCTGGG - Intergenic
1141638469 16:85328218-85328240 GGCTTGCTGTGGAGGAGGAGCGG - Intergenic
1141697699 16:85627953-85627975 GTCTCCCTGGGGAGGGCTGGGGG + Intronic
1141734049 16:85840484-85840506 GTCACCCAGGGGTGGAGGGGTGG + Intergenic
1141791037 16:86234249-86234271 GCCTTCCTTTGGAGGAGGAGAGG - Intergenic
1141794726 16:86263123-86263145 GCCTCCCTTTGGAGGAGGAGAGG - Intergenic
1141918165 16:87114964-87114986 TTCTCTCTGGGGATGAGCAGAGG - Intronic
1142066656 16:88066833-88066855 GTCTCCCAAGGGAGCACGAGAGG - Intronic
1142145892 16:88492829-88492851 GTGTCCCTTGGGAGAAGGAGAGG - Intronic
1142235000 16:88917997-88918019 GCCTCCCTGGAGTGGAGGAGTGG + Intronic
1142396666 16:89835834-89835856 GTCTCTCTGGGACTGAGGAGCGG + Intronic
1142983186 17:3683144-3683166 GTCTCCCTCTGCTGGAGGAGAGG - Intronic
1143515692 17:7418230-7418252 GTCTCCAGGGGGAGGGAGAGGGG - Exonic
1144151714 17:12454957-12454979 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1144298188 17:13899278-13899300 GACTCCCTGGGTCGGAGGTGAGG - Intergenic
1144322357 17:14141192-14141214 GTCACACTGGGGAGGAGGAGTGG - Intronic
1144448675 17:15355739-15355761 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1145249415 17:21289229-21289251 GCCTCCCTTGGGAGGGTGAGTGG + Intronic
1145718289 17:27044678-27044700 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1146160990 17:30559469-30559491 TTGGCCCTGGGGAGGAGGGGTGG - Exonic
1146392442 17:32435306-32435328 GTCCTCCTGGGGAGGAGGAAAGG - Intergenic
1146494560 17:33309938-33309960 GACTCCATGGGGTGGAGGGGAGG - Intronic
1146539265 17:33680444-33680466 GCCTCCCCAGGGAGGAGCAGAGG + Intronic
1146562016 17:33878200-33878222 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1146798560 17:35800316-35800338 CACTTCCTGGGGAGGAGGAAGGG - Intronic
1146812936 17:35918117-35918139 ATCGCCCTGGTGACGAGGAGCGG - Exonic
1147322407 17:39654050-39654072 GGCTCCCGAGAGAGGAGGAGGGG + Intronic
1147563244 17:41521622-41521644 ATTTCCCTGGGGAACAGGAGAGG - Exonic
1147840587 17:43368924-43368946 TTCTGCCCGGGAAGGAGGAGAGG + Intergenic
1148331034 17:46814132-46814154 GGATCCCTGGGGTGGAGGTGGGG + Intronic
1148605491 17:48926160-48926182 GAGTCCCTGGGGAGGAGTACAGG + Intronic
1148754299 17:49964619-49964641 AGCTCCCGGGGGAGGAGGAGGGG - Intergenic
1148805758 17:50263236-50263258 GGCTGGATGGGGAGGAGGAGAGG - Intergenic
1148907256 17:50919392-50919414 CTCTCACTGGGGAGGAGGAGAGG - Intergenic
1148953100 17:51331990-51332012 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1149054548 17:52347340-52347362 GTGTCCTTGGGCAGGAGGAGGGG + Intergenic
1149371991 17:56003475-56003497 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1149618946 17:58027063-58027085 GTATCTCTGGGCAGGAGGTGGGG + Intergenic
1150355919 17:64484546-64484568 CTCTATCAGGGGAGGAGGAGTGG + Intronic
1150837365 17:68576539-68576561 CTCTCCCTGGGGAGGAGGCTGGG - Intronic
1151347562 17:73511529-73511551 ATGACTCTGGGGAGGAGGAGAGG + Intronic
1151381317 17:73727596-73727618 GTCTCCCTGGGCAGCAAGTGAGG + Intergenic
1151391634 17:73791200-73791222 GTATCCCTGGACAGGGGGAGGGG - Intergenic
1151447573 17:74177117-74177139 ACCTCCCTGGTGATGAGGAGGGG + Intergenic
1152429231 17:80238473-80238495 GCCTCCCTGGGGGCGAGGAGGGG - Intronic
1152738435 17:82008699-82008721 GTCTCCATGGGGGGGAGGGGTGG - Intronic
1152861560 17:82699117-82699139 GTCTCCCTGGTGGGCAGGTGGGG - Intergenic
1153105454 18:1521238-1521260 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1153221359 18:2865266-2865288 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1153354139 18:4117411-4117433 AACCCCCTGGGGTGGAGGAGGGG - Intronic
1153443819 18:5150589-5150611 GGATGCCTGGGGATGAGGAGAGG - Intronic
1154011342 18:10577712-10577734 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1154255792 18:12779841-12779863 CTCTTCCTGCGGAGGAGGCGCGG - Intergenic
1154958805 18:21287324-21287346 AACTCCTTGGGGAGTAGGAGAGG + Intronic
1155321509 18:24624097-24624119 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1155330928 18:24715869-24715891 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1155427028 18:25717227-25717249 GTATTCCTTTGGAGGAGGAGAGG - Intergenic
1155568392 18:27162861-27162883 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1155617845 18:27742777-27742799 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1156477282 18:37413756-37413778 GGCTCCTTGGAGAGGAGGAATGG - Intronic
1156483639 18:37451181-37451203 GGCTCCCTTGGGAGGAGGAGGGG + Intronic
1156489216 18:37486396-37486418 GATTCCCTGGCGAGGAGGTGGGG - Intronic
1156709455 18:39925342-39925364 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1156725205 18:40119110-40119132 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1157056729 18:44238181-44238203 GTCTCACTGGGAAGGTGGATTGG + Intergenic
1157286175 18:46378903-46378925 GCCACACTGGGGAGGAAGAGTGG - Intronic
1157482183 18:48062314-48062336 TCCTCCCTGGGGAGAGGGAGAGG - Intronic
1157914860 18:51654952-51654974 GTCACAATGGGGAGGCGGAGTGG - Intergenic
1158307082 18:56117571-56117593 CTCTGCCAGGGGAAGAGGAGGGG - Intergenic
1158647232 18:59257722-59257744 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1158834401 18:61315632-61315654 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1159155220 18:64573622-64573644 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1159460006 18:68712631-68712653 CTCTTCCTGAGGAGGAGGAAGGG - Intronic
1160485611 18:79289661-79289683 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1160550966 18:79693750-79693772 TTCTTCCTGGGGAGGAGGATGGG - Intronic
1160733060 19:649852-649874 GGGTCCCTGGTGAGTAGGAGGGG - Intronic
1160733097 19:649944-649966 GGGTCCCTGGTGAGTAGGAGGGG - Intronic
1160733174 19:650128-650150 GGGTCCCTGGTGAGTAGGAGGGG - Intronic
1160978375 19:1805451-1805473 GTCTCCCTGGTGACGAGGAGAGG + Exonic
1160997248 19:1888488-1888510 GGGTCTCTGGGGAGGAGGAAGGG - Intergenic
1161121142 19:2527448-2527470 GTCCCCACTGGGAGGAGGAGAGG + Intronic
1161363957 19:3868071-3868093 GTCTGGCTGGGCAGGAGGAGGGG - Intronic
1161364051 19:3868407-3868429 GTCTGGCTGGGCAGGAGGAGGGG - Intronic
1161455870 19:4369516-4369538 CTCTCACAGGGCAGGAGGAGAGG + Intronic
1162034918 19:7933565-7933587 GCCTCCCTGGGGAAGAGGGTGGG + Exonic
1162402425 19:10454188-10454210 ATCACCCAGGGGAGGGGGAGGGG - Intronic
1162525539 19:11204125-11204147 AGATCCCTGGGGATGAGGAGTGG + Intronic
1162798900 19:13100535-13100557 GTCTCCCCGAGGTGGAGTAGAGG + Intronic
1163153987 19:15430147-15430169 GACTCTCAGGGGAGGAGAAGCGG - Intronic
1163173544 19:15549243-15549265 GGCTCCCTGGGGCGCAGGGGAGG - Intronic
1163972173 19:20808788-20808810 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1164420641 19:28088726-28088748 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1164552963 19:29226731-29226753 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1164821102 19:31251773-31251795 TCCTGCCTGGGGAGGTGGAGTGG + Intergenic
1165013306 19:32864007-32864029 GACTCACTGGGGAGGAGCTGAGG + Intronic
1165069302 19:33246727-33246749 GCCTGCCTGGGGAGGCAGAGTGG - Intergenic
1165225107 19:34349251-34349273 GTCTCCCTGTGTGAGAGGAGGGG + Intronic
1165256537 19:34579919-34579941 GTGTCCCTGGGGCTGAGGATGGG + Intergenic
1165311139 19:35030212-35030234 GACTCCCTGGGAAGGTGGGGGGG + Intergenic
1165363617 19:35351186-35351208 GACTCTGTGGGGAGGAGGGGTGG - Intergenic
1165365750 19:35363643-35363665 GACTCTGTGGGGAGGAGGGGTGG - Intergenic
1165490931 19:36122192-36122214 GTCCACCTGGGGAAGGGGAGCGG + Intronic
1165563513 19:36702974-36702996 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1166750660 19:45162662-45162684 GTCTTCCTGGGGAGCAGGGCTGG - Intronic
1166753714 19:45178102-45178124 GGCTCCGTGGGGAGGAAGCGGGG - Exonic
1166822760 19:45590814-45590836 GTCCCCCTGGGAGGGCGGAGTGG + Exonic
1166994033 19:46710806-46710828 GACAGCGTGGGGAGGAGGAGCGG - Intronic
1167103565 19:47418483-47418505 GTCTCCCTGGGGATGGGAACGGG - Intronic
1167368040 19:49064919-49064941 GAATCCCGAGGGAGGAGGAGTGG + Intronic
1167435334 19:49475579-49475601 GACACCCAGGGAAGGAGGAGCGG + Intronic
1167575655 19:50316282-50316304 GGCTGGCTGGGGAGGGGGAGGGG + Intronic
1167703619 19:51065610-51065632 GTCTGCCTGGGGCGGGGGCGGGG - Intergenic
1167756811 19:51417842-51417864 AGCTCCCTGTGTAGGAGGAGAGG + Intergenic
1168259590 19:55185980-55186002 TTCACCTGGGGGAGGAGGAGGGG + Exonic
1168333877 19:55585942-55585964 GGCTCCCTGGGCAGGGGGCGGGG + Intergenic
1168392961 19:56025843-56025865 GTGGCCTTGGGGAGGGGGAGGGG - Intronic
1168471296 19:56643049-56643071 GCTTCCCGGGGGTGGAGGAGGGG + Intergenic
1168719003 19:58544720-58544742 GGCGCCCAGGGGGGGAGGAGGGG - Exonic
1202647016 1_KI270706v1_random:152500-152522 ATCTCTCTTCGGAGGAGGAGAGG - Intergenic
1202647184 1_KI270706v1_random:153110-153132 ATCTCCCTCAGGTGGAGGAGTGG - Intergenic
925169538 2:1742784-1742806 GTCTCTCTGCGGAGGAGGAGAGG + Intronic
925332589 2:3070609-3070631 GTTTTCCTGGAGAGCAGGAGAGG - Intergenic
925342369 2:3146384-3146406 CTCGCCCTGGGGAGGTGGTGGGG + Intergenic
926371292 2:12181281-12181303 ATGTCACTGGAGAGGAGGAGGGG + Intergenic
927058331 2:19389014-19389036 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
927159385 2:20243078-20243100 CTCGCCCTGGAGAAGAGGAGGGG - Intergenic
927204700 2:20599825-20599847 GTCTCCCTGGGGAACAGATGGGG - Intronic
927420245 2:22923629-22923651 GTATCCCTGTGGAGGCTGAGAGG + Intergenic
927703662 2:25283866-25283888 GCCTCCCTGGGAAGCAGGTGAGG + Intronic
928545282 2:32323720-32323742 GTCTACCTGGAGAGAAGAAGGGG - Intergenic
928765138 2:34636404-34636426 GCCTTCCTTTGGAGGAGGAGAGG - Intergenic
928795455 2:35013524-35013546 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
929295049 2:40237654-40237676 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
929891689 2:45923751-45923773 GGCTCCCTGGGGAGGGGGCTGGG + Intronic
930075251 2:47401147-47401169 ATCACCCTGGGGAGGTGGGGGGG - Intergenic
930086999 2:47504627-47504649 GTCTCCCTGGTGAGTGGGAGTGG - Intronic
930276062 2:49312515-49312537 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
930434034 2:51317756-51317778 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
930598082 2:53411978-53412000 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
930615404 2:53587978-53588000 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
931030843 2:58172729-58172751 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
931624837 2:64247930-64247952 GTCACCTTGGGGATGAGAAGTGG + Intergenic
931698835 2:64892098-64892120 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
931846311 2:66207276-66207298 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
931888810 2:66647645-66647667 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
932070833 2:68618703-68618725 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
932077507 2:68679096-68679118 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
932591076 2:73068097-73068119 GTCTCCCTGTGCAAGAGGACGGG - Intronic
932595041 2:73088343-73088365 GCCACCCTGGAGAGGAGGAGGGG - Exonic
932644211 2:73485124-73485146 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
932781554 2:74561689-74561711 TCCTCTCTGGGGAGGAGGTGGGG + Intronic
933550478 2:83769258-83769280 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
933728367 2:85438782-85438804 CCCTCCCTGGGGAGAAAGAGAGG + Intergenic
933799047 2:85945132-85945154 GTCTAGTTGGGGAGGAGGAGTGG - Intergenic
934037045 2:88096898-88096920 GTCACCCTGGGGAGGAGGCAGGG + Intronic
934067069 2:88350469-88350491 GTGGGTCTGGGGAGGAGGAGGGG + Intergenic
934935133 2:98459871-98459893 GTCTAACTGAGGAGAAGGAGGGG + Intronic
935369080 2:102325444-102325466 GTGTTCCTCTGGAGGAGGAGGGG - Intronic
936576139 2:113657097-113657119 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
936612758 2:114018023-114018045 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
937371777 2:121303297-121303319 GTCCCCCTGGGGAGAGAGAGAGG + Intergenic
937489524 2:122351339-122351361 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
937780084 2:125826611-125826633 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
937810798 2:126196686-126196708 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
937994363 2:127681495-127681517 CTCTCCCTGGGCAGGAGGCTTGG + Intronic
938109513 2:128554421-128554443 GTCTCTCTGGGGAGGCTCAGGGG + Intergenic
938167398 2:129043193-129043215 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
938176951 2:129142566-129142588 CTCTCCCTGGCCAGGAGGATGGG + Intergenic
938397605 2:130962875-130962897 GTCTCCCTTTGGAGGTTGAGGGG - Intronic
938405790 2:131032439-131032461 TCCTCCCTGGGGCTGAGGAGGGG - Intronic
938548056 2:132353013-132353035 ATCTCCCTCAGGTGGAGGAGTGG + Intergenic
938567266 2:132529945-132529967 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
938720284 2:134061346-134061368 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
938864526 2:135404044-135404066 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
939582086 2:143962299-143962321 GTCTACATGGGGAGGAAGAAAGG + Intronic
939943510 2:148381060-148381082 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
940276692 2:151947430-151947452 GTTTCCCTAGGCAGGGGGAGTGG + Intronic
941053500 2:160761970-160761992 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
941056850 2:160798411-160798433 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
941337330 2:164262070-164262092 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
941489427 2:166125358-166125380 TTCTCCCTGGGCAGTTGGAGAGG - Intronic
942056836 2:172192317-172192339 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
942400143 2:175593601-175593623 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
942753674 2:179315568-179315590 GTGTCCCTTTGGAGGAGAAGAGG - Intergenic
942956635 2:181781390-181781412 ATCTCACTGGGGAGGAGGCAGGG - Intergenic
943097992 2:183453358-183453380 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
943130770 2:183850474-183850496 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
943255683 2:185590939-185590961 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
943310055 2:186313852-186313874 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
943883041 2:193171660-193171682 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
944035485 2:195290268-195290290 GAGTCCTTGGGGAAGAGGAGCGG + Intergenic
944147914 2:196526527-196526549 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
944619377 2:201498364-201498386 ATGTCCCAGGGCAGGAGGAGAGG + Intronic
945267136 2:207901680-207901702 ATCTTGCTGGGGAGGAGGAAGGG - Intronic
945481621 2:210351700-210351722 GTGTTCCTTTGGAGGAGGAGTGG - Intergenic
945568942 2:211439859-211439881 GTCTCCCAGGGGTAGAGAAGGGG + Intronic
946164026 2:217853028-217853050 GTCTCTGGTGGGAGGAGGAGGGG - Intronic
946879248 2:224160941-224160963 GTCTGCAGGGTGAGGAGGAGAGG + Intergenic
947040251 2:225910417-225910439 GTATCTCTGGGGAGAAGCAGGGG - Intergenic
947262021 2:228234079-228234101 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
947290592 2:228569216-228569238 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
947465501 2:230341541-230341563 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
947945489 2:234098184-234098206 GCCTCCCCGGGGAAAAGGAGAGG + Intergenic
948012724 2:234662849-234662871 GTCACCCTGGGAAACAGGAGAGG - Intergenic
948039645 2:234889344-234889366 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
948280133 2:236740697-236740719 GCCTTCCTGAGAAGGAGGAGAGG - Intergenic
948465409 2:238149602-238149624 TTCTCCCTGAGAAGGAGGACAGG - Intronic
948481692 2:238254326-238254348 GCCTCCCTGGGGAGTGGGAGGGG + Intronic
948493232 2:238327289-238327311 GTCAGCCTGGGAGGGAGGAGAGG - Intronic
948560724 2:238849332-238849354 GTTTGCCTGGGGAGGACGGGAGG + Intronic
948730781 2:239962526-239962548 GGCTTTCTGGGGAGGAGGAAGGG - Intronic
949031454 2:241799255-241799277 GTCTCCCTCTGGAAGAGGAGGGG + Intronic
1168856760 20:1014136-1014158 GGCTCCTTGGGAGGGAGGAGGGG - Intergenic
1168875019 20:1165338-1165360 GTCTCCCTTGGGAAGTGGAGAGG - Exonic
1169207841 20:3749952-3749974 GGCCCCCTGGGGTGGAGCAGGGG - Exonic
1169444048 20:5656859-5656881 GTGGCCCAGGGAAGGAGGAGAGG + Intergenic
1170012487 20:11741187-11741209 GCCCAGCTGGGGAGGAGGAGAGG - Intergenic
1170078614 20:12448166-12448188 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1170325573 20:15151894-15151916 CTCTGCCTGGCGAGGAGGGGAGG + Intronic
1170613021 20:17929526-17929548 ATCTCCCTGGGCTGGAGGTGAGG - Intergenic
1171068697 20:22045508-22045530 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1171255007 20:23684076-23684098 CTCTTCCTGGGGAAGTGGAGGGG - Intergenic
1171262362 20:23746003-23746025 CTCTTCCTGGGGAAGTGGAGGGG - Intergenic
1171407693 20:24922802-24922824 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1171733266 20:28737605-28737627 GCCTTCCTTTGGAGGAGGAGAGG - Intergenic
1171748420 20:29023017-29023039 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1171763279 20:29232915-29232937 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1171772228 20:29331559-29331581 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1171891815 20:30724341-30724363 ATCTCCCTTCCGAGGAGGAGCGG - Intergenic
1171941489 20:31333789-31333811 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1172509931 20:35493575-35493597 GACTTGGTGGGGAGGAGGAGGGG - Intronic
1172589261 20:36105936-36105958 TGCCCCCTGGGGAGGAGGGGAGG - Intronic
1172648236 20:36484731-36484753 GTCTTCCTGGGGAGCAAGGGAGG + Intronic
1172793959 20:37524448-37524470 GACTCACTGGGGAGTGGGAGAGG - Intronic
1173346777 20:42207234-42207256 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1173505453 20:43583596-43583618 GTCTCTCTGTGGAGGAGGCCTGG - Intronic
1173648061 20:44646028-44646050 GTCTGGCTGGGGAGGTGGAGAGG - Intronic
1173709711 20:45143846-45143868 CTCTGCCGGGGGATGAGGAGGGG + Intergenic
1173730598 20:45325627-45325649 GTCTCCCTGGGTAGGGGGGGGGG - Exonic
1173770536 20:45652525-45652547 GTCTTCCTTTGGAGGAGGAGAGG - Intronic
1173774480 20:45692877-45692899 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1173883545 20:46437344-46437366 TTCTCCCTGGGGTGGGGGTGAGG + Intergenic
1174140292 20:48408361-48408383 CTCTGCCTGGGGAGGGGGAGAGG - Intergenic
1174143745 20:48435870-48435892 GTCACCCTGGGGGAGAGGTGGGG - Intergenic
1174278066 20:49418141-49418163 CTGCCCCTGGGGAGGAGGACGGG + Intronic
1174387000 20:50193262-50193284 GTGTCCCTGGCCAGCAGGAGGGG + Intergenic
1174406158 20:50304668-50304690 ATCTCCATGGAGTGGAGGAGGGG + Intergenic
1174535880 20:51251283-51251305 GTCACCCTGGGGTGGGGGTGAGG - Intergenic
1174966791 20:55225371-55225393 GTATTCCTTTGGAGGAGGAGAGG + Intergenic
1175026156 20:55905294-55905316 GCGTCCCTTTGGAGGAGGAGAGG + Intergenic
1175290426 20:57871529-57871551 GACCCCATGGGGAGGTGGAGTGG - Intergenic
1175308392 20:57993902-57993924 GTCTCGCTGGAGAACAGGAGGGG + Intergenic
1175459777 20:59143640-59143662 GTCCTTCTGGGGAGGAGGATGGG + Intergenic
1176047714 20:63101319-63101341 GGTTCCCTGGGTGGGAGGAGCGG - Intergenic
1176121843 20:63457618-63457640 GGCTCCCTCGGGAACAGGAGTGG + Intronic
1176604684 21:8819664-8819686 ATCTCCCTCAGGTGGAGGAGTGG + Intergenic
1176604853 21:8820274-8820296 ATCTCTCTTCGGAGGAGGAGAGG + Intergenic
1176625364 21:9087634-9087656 ATCTCCCTTCCGAGGAGGAGCGG + Intergenic
1177116403 21:17091463-17091485 GCATTCCTGTGGAGGAGGAGAGG - Intergenic
1177123204 21:17163975-17163997 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1178464473 21:32834323-32834345 GTGTCCCTGGGAAGTAGGTGCGG + Intergenic
1178537938 21:33425610-33425632 GTGTCCCTGGGCAGGCTGAGTGG + Intronic
1178686247 21:34712935-34712957 GTCTCTCTGGGGCAGAGCAGTGG + Intronic
1178891294 21:36523047-36523069 GTGTCCCTGGGGAGGTGGGGAGG - Intronic
1179226049 21:39454491-39454513 GAGACCCTGGGGAGCAGGAGAGG + Intronic
1179457117 21:41507666-41507688 TTCTCTTTGGGGAGGAGGACTGG - Intronic
1179506401 21:41844691-41844713 GTGTCCCTGTGATGGAGGAGGGG - Intronic
1179614273 21:42571686-42571708 GTATAACTGAGGAGGAGGAGGGG - Intronic
1179661500 21:42878978-42879000 GTCTCCCTGGTGAGAAGGGAGGG - Intronic
1179818331 21:43922227-43922249 CTCAGCCTGGGGACGAGGAGTGG + Intronic
1179953828 21:44727070-44727092 GTGGACCTGGGGAGGAGGAGCGG - Intergenic
1180163548 21:46008710-46008732 GCCTCCCAGGTCAGGAGGAGAGG + Intergenic
1180229917 21:46421165-46421187 GGCACACTGGGGAGGAGTAGAGG - Intronic
1180346974 22:11711269-11711291 ATCTCCCTCAGGTGGAGGAGTGG + Intergenic
1180347143 22:11711879-11711901 ATCTCTCTTCGGAGGAGGAGAGG + Intergenic
1180354720 22:11829359-11829381 ATCTCCCTCAGGTGGAGGAGTGG + Intergenic
1180354891 22:11829969-11829991 ATCTCTCTTCGGAGGAGGAGAGG + Intergenic
1180383360 22:12162362-12162384 ATCTCTCTTCGGAGGAGGAGAGG - Intergenic
1180383532 22:12162973-12162995 ATCTCCCTCAGGTGGAGGAGTGG - Intergenic
1180414736 22:12698329-12698351 GTATTCCTTTGGAGGAGGAGAGG - Intergenic
1180848699 22:18999207-18999229 GTCTCCCTGGTGCGGATGCGGGG + Intergenic
1180979608 22:19872407-19872429 GGGACCCTGGGGAGGAGAAGTGG + Intergenic
1181015543 22:20066493-20066515 GTCCACCTAGGGAGGAGCAGGGG + Intergenic
1181305737 22:21916372-21916394 GTCTGCCTGGGGAAGGGGTGGGG - Intergenic
1181310032 22:21939675-21939697 GCCTTCCTAGGGATGAGGAGGGG + Exonic
1181536496 22:23548997-23549019 GGCTCCCTCCTGAGGAGGAGAGG + Intergenic
1181604269 22:23970931-23970953 GCAACCCTGGGGAGGAGGAGGGG + Intronic
1181727488 22:24821519-24821541 GTCCCCCTGGGGAGGTGGCAGGG + Intronic
1182045917 22:27274039-27274061 TTCCCCCTGAGGAGGAGGTGGGG + Intergenic
1182180129 22:28338923-28338945 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1182558752 22:31142898-31142920 GTCTCCCTAGGGAGAGGCAGGGG - Intergenic
1182982079 22:34682417-34682439 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1183284829 22:36955101-36955123 GGCTCCAAGTGGAGGAGGAGGGG + Intergenic
1183314621 22:37129975-37129997 CTCTCCCTGGAGAGGAGAACTGG - Intronic
1183414795 22:37676043-37676065 GGCTCTTTGGGGTGGAGGAGGGG - Intronic
1183926622 22:41211002-41211024 GTGACCCTGGGTAGGAGGACTGG + Intronic
1184111476 22:42398082-42398104 GTTTCCCTGGAGAGGGTGAGTGG - Intronic
1184322702 22:43754573-43754595 GGTTCCATGGGGAGGAGGATGGG + Intronic
1184345280 22:43909228-43909250 GACTGCCAGGGGAGGCGGAGAGG + Intergenic
1184359192 22:44003960-44003982 GGCTCCCTGGAGAAGGGGAGTGG - Intronic
1184403470 22:44286981-44287003 CTCTCCCTGGGGATGTGCAGCGG - Intronic
1184750344 22:46482392-46482414 GCCTCCCTGGGTAGCTGGAGAGG + Intronic
1185012348 22:48321255-48321277 GAACCCCTAGGGAGGAGGAGAGG - Intergenic
1185231565 22:49686931-49686953 TGCTCCATGGGCAGGAGGAGGGG - Intergenic
949201041 3:1379685-1379707 TTCTTCCTGAGGAGGAGGTGGGG + Intronic
949457480 3:4254205-4254227 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
949600753 3:5595841-5595863 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
950109955 3:10412584-10412606 GTCCTCCTGGGGTGGAGGGGAGG - Intronic
950467234 3:13162762-13162784 GTGGCCCTGAGGAGGAGGAGGGG - Intergenic
950535823 3:13577572-13577594 GGATCCCTGGCTAGGAGGAGTGG + Intronic
950908131 3:16557263-16557285 GTCTCCCTGCTGAGGGAGAGGGG - Intergenic
951042598 3:18004738-18004760 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
951086392 3:18517036-18517058 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
951101424 3:18693321-18693343 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
951964638 3:28369208-28369230 GTATTCCTTTGGAGGAGGAGAGG + Intronic
952104285 3:30051205-30051227 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
952515049 3:34095152-34095174 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
952575023 3:34764164-34764186 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
953133092 3:40160044-40160066 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
953524829 3:43680028-43680050 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
953696858 3:45166606-45166628 GCCTCACTGGGGAGCGGGAGAGG + Intergenic
953735337 3:45489437-45489459 GTATCCCTGGGGTGGGGGTGGGG - Intronic
954036452 3:47853518-47853540 GTCTCCCAGGTGAGGTGGGGTGG - Intronic
954133678 3:48572416-48572438 GGCTCCCTGGTAAGGGGGAGAGG + Exonic
954464539 3:50646831-50646853 GCCTGCCATGGGAGGAGGAGGGG - Intronic
954548248 3:51457005-51457027 GTGTTCCTTCGGAGGAGGAGAGG - Intronic
955014049 3:55051153-55051175 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
955048941 3:55389800-55389822 GTGTTCCTCTGGAGGAGGAGAGG - Intergenic
955211589 3:56946220-56946242 GTATTCCTTTGGAGGAGGAGAGG - Intronic
955754706 3:62215753-62215775 CTCACCCTGTAGAGGAGGAGAGG + Intronic
955899241 3:63734266-63734288 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
956089811 3:65653920-65653942 ATTTCCATGGTGAGGAGGAGGGG + Intronic
956207301 3:66768711-66768733 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
956854376 3:73261552-73261574 GCATCCCTGGGGAAGAAGAGAGG + Intergenic
957018440 3:75097037-75097059 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
957061805 3:75488514-75488536 GTATTCCTTTGGAGGAGGAGAGG + Intergenic
957727616 3:84087714-84087736 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
957806413 3:85154031-85154053 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
957867200 3:86040175-86040197 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
957948724 3:87097293-87097315 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
958090526 3:88870789-88870811 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
958176035 3:89997051-89997073 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
958255387 3:91319680-91319702 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
958527879 3:95286865-95286887 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
958624413 3:96606389-96606411 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
958832938 3:99111410-99111432 CTCTCTATGGAGAGGAGGAGGGG + Intergenic
959013774 3:101109404-101109426 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
959504798 3:107145172-107145194 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
959522393 3:107334830-107334852 GCCTTCCTTTGGAGGAGGAGAGG - Intergenic
959833280 3:110889775-110889797 GTATTCCTTTGGAGGAGGAGAGG - Intronic
959891439 3:111561258-111561280 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
960000389 3:112725202-112725224 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
960339400 3:116456280-116456302 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
960546000 3:118915198-118915220 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
960568885 3:119165582-119165604 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
960740799 3:120831259-120831281 GGCTCCCTGGGGAGGGCGTGCGG + Intergenic
961217435 3:125170967-125170989 CTCCCTCTGGGGAGTAGGAGTGG + Intronic
961636685 3:128337428-128337450 GGCTTGATGGGGAGGAGGAGGGG + Intronic
961736202 3:129003594-129003616 GCCTCCCTGGGGATGTGGCGAGG + Intronic
961749442 3:129086741-129086763 GTCACCCTGAGGAAGAAGAGGGG - Intergenic
962219599 3:133552411-133552433 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
962258937 3:133890968-133890990 GTAGCCCAGGGGAGCAGGAGTGG + Intronic
962831600 3:139147229-139147251 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
962980464 3:140485009-140485031 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
964228828 3:154438622-154438644 GTGTCCCTTTGGAGGAGGAGAGG + Intergenic
964322302 3:155511404-155511426 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
964392889 3:156215733-156215755 GGCTACCTGGGGAGGAAGAAAGG + Intronic
964477631 3:157110974-157110996 GTCTCCATGGTTTGGAGGAGTGG - Intergenic
964532830 3:157686284-157686306 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
964564561 3:158035222-158035244 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
964694522 3:159492193-159492215 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
964860378 3:161195359-161195381 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
965228820 3:166026150-166026172 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
965271172 3:166618515-166618537 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
965382908 3:168011984-168012006 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
965445517 3:168769497-168769519 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
965666960 3:171105426-171105448 GTCTCCTAAGGGAAGAGGAGTGG + Intronic
966115192 3:176453215-176453237 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
966313160 3:178616530-178616552 TGCTGCCTGGGGTGGAGGAGGGG + Intronic
966612979 3:181886723-181886745 GTATCCCTGGAGAGGAGGAAGGG + Intergenic
966794263 3:183698402-183698424 GCCTCCCTGGGATGGAGGGGAGG + Intronic
967339147 3:188377755-188377777 GTGTTCCTTTGGAGGAGGAGTGG + Intronic
968263068 3:197340436-197340458 CTCTGGCTGGGGAGGAGGATGGG + Intergenic
968309701 3:197673329-197673351 GTCTCCCAGGGAAGTGGGAGAGG - Intronic
968353376 3:198080890-198080912 ATCTCTCTTCGGAGGAGGAGCGG - Intergenic
968353560 3:198081523-198081545 AACTCCCTGCGGTGGAGGAGTGG - Intergenic
968486578 4:865911-865933 GTATCCATGGGGAGGAGGTCAGG - Intronic
968551616 4:1226338-1226360 GTCTCCCTGGGGAGGAGGAGGGG + Intronic
968649293 4:1754054-1754076 CTCCCCCTGGGGAGGAGCACGGG - Intergenic
969149969 4:5160982-5161004 GTCGCTGTGGGGAGTAGGAGGGG + Intronic
969239718 4:5890391-5890413 TTCTCCCTGGGCTGCAGGAGGGG - Intronic
969342277 4:6549675-6549697 TCCTCCCTAGGGATGAGGAGGGG - Intronic
969370887 4:6731046-6731068 GTCACCCTGGGGAAGTAGAGCGG + Intergenic
969495138 4:7522225-7522247 CTCACCCTGAGGAGGAGGGGTGG + Intronic
969509080 4:7607345-7607367 ATCCTCCTGGGGAGGTGGAGAGG + Intronic
969874166 4:10123715-10123737 GCCTCCCTGTGGGGGAGGGGGGG + Intergenic
970022209 4:11582423-11582445 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
970332421 4:15001416-15001438 GTCTCCCTGGGGGGAAGGGGCGG + Intergenic
970521936 4:16893518-16893540 AACTCCCTGGGGAGGGGGTGGGG - Intronic
970985083 4:22147386-22147408 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
971113473 4:23615728-23615750 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
971384460 4:26130306-26130328 CACTCCTTGGGGAGGAGGATGGG - Intergenic
971955299 4:33410151-33410173 GTCCCCTTGGGGAGCAGGATTGG + Intergenic
972376630 4:38477557-38477579 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
973373269 4:49270663-49270685 ATCTCTCTTCGGAGGAGGAGAGG - Intergenic
973373441 4:49271273-49271295 ATCTCCCTCAGGTGGAGGAGTGG - Intergenic
973387571 4:49523935-49523957 ATCTCCCTCAGGTGGAGGAGTGG + Intergenic
973387737 4:49524545-49524567 ATCTCTCTTCGGAGGAGGAGAGG + Intergenic
973597195 4:52504396-52504418 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
973806733 4:54533985-54534007 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
973859043 4:55042369-55042391 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
973984354 4:56336286-56336308 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
974244366 4:59294877-59294899 CTCACCCTGGGTAGGAGGGGAGG - Intergenic
974443114 4:61944985-61945007 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
974530062 4:63097348-63097370 GCCTTCCTTTGGAGGAGGAGAGG + Intergenic
974591422 4:63953124-63953146 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
974682126 4:65177542-65177564 GTATTCCTTTGGAGGAGGAGAGG - Intergenic
974723425 4:65771189-65771211 GTGTTCCTTTGGAGGAGGAGGGG + Intergenic
975034679 4:69664963-69664985 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
975157584 4:71089446-71089468 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
975250099 4:72168818-72168840 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
975287073 4:72633125-72633147 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
975345829 4:73292152-73292174 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
975368098 4:73551714-73551736 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
975751928 4:77533085-77533107 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
975805420 4:78106690-78106712 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
975983418 4:80183657-80183679 TGGCCCCTGGGGAGGAGGAGCGG - Intergenic
975999295 4:80353685-80353707 TTCTCCCTGGGCAGGTTGAGAGG + Intronic
976777105 4:88719067-88719089 GACTGTCTGGGGAGGTGGAGGGG - Intergenic
976837351 4:89390286-89390308 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
976924851 4:90484421-90484443 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
977485116 4:97634432-97634454 GCCTTCCTTTGGAGGAGGAGAGG - Intronic
977619078 4:99116715-99116737 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
977699484 4:100005579-100005601 GCGTCCCTTTGGAGGAGGAGAGG + Intergenic
978004732 4:103602434-103602456 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
978022507 4:103831498-103831520 GTGTTCCTTTGGAGGAGGAGGGG + Intergenic
978274748 4:106936058-106936080 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
978418527 4:108504208-108504230 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
978591164 4:110326861-110326883 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
978626601 4:110692712-110692734 GCGTTCCTGTGGAGGAGGAGAGG + Intergenic
978658875 4:111099689-111099711 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
978680868 4:111378997-111379019 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
978859229 4:113429601-113429623 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
979778160 4:124616985-124617007 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
979965057 4:127067627-127067649 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
980033801 4:127860616-127860638 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
980206006 4:129720533-129720555 GTCTTCCTTTGGAGGGGGAGAGG + Intergenic
980231425 4:130051250-130051272 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
980326499 4:131353343-131353365 GCCTTCCTTTGGAGGAGGAGAGG - Intergenic
981289569 4:143058442-143058464 GTCTTCCTTGGGAGAAGCAGAGG - Intergenic
981365189 4:143894359-143894381 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
981556651 4:146002796-146002818 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
981839383 4:149093639-149093661 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
981887910 4:149699930-149699952 CTCTCCCTGCAGCGGAGGAGGGG + Intergenic
982052176 4:151512394-151512416 GTGTTCCTTTGGAGGAGGAGCGG - Intronic
982745763 4:159103255-159103277 GTCTGCGCGGGGCGGAGGAGGGG - Intergenic
982759846 4:159268330-159268352 GTCTGCTTGGAGAGGAGGGGAGG + Intronic
983181120 4:164650136-164650158 GTGTTCCTTCGGAGGAGGAGAGG - Intergenic
983182810 4:164668448-164668470 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
984758194 4:183342944-183342966 CCCTCCCAGGGGAGGAAGAGAGG - Intergenic
985439008 4:189964815-189964837 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
985550556 5:531418-531440 GGGTCCCTGGAGGGGAGGAGAGG - Intergenic
985577775 5:681682-681704 GACTCCCTGGGGAGGCGCTGGGG - Intronic
985769059 5:1797647-1797669 GTGTCCCTGGCCAGGAGGAAAGG + Intergenic
986385763 5:7231677-7231699 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
987184079 5:15397208-15397230 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
987305862 5:16637656-16637678 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
987424139 5:17754652-17754674 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
988871687 5:35397171-35397193 GTATTCCTTTGGAGGAGGAGAGG - Intergenic
988880372 5:35495324-35495346 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
988887381 5:35573271-35573293 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
989355843 5:40542261-40542283 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
989493048 5:42079237-42079259 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
989508757 5:42259285-42259307 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
989674160 5:43953961-43953983 GCATTCCTGTGGAGGAGGAGAGG - Intergenic
989679795 5:44014867-44014889 GCATTCCTGTGGAGGAGGAGAGG - Intergenic
989845185 5:46131972-46131994 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
989947922 5:50262028-50262050 GCGTTCCTTGGGAGGAGGAGAGG + Intergenic
989965065 5:50458038-50458060 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
990071650 5:51790200-51790222 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
990084077 5:51952821-51952843 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
990093756 5:52087243-52087265 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
990191963 5:53269080-53269102 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
990210758 5:53480090-53480112 GTCTCTTTGGAGCGGAGGAGAGG + Intergenic
990269162 5:54116146-54116168 CCATCCCTGGGGAGCAGGAGGGG + Intronic
990366868 5:55080411-55080433 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
990600744 5:57356549-57356571 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
990884327 5:60575007-60575029 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
990912008 5:60861345-60861367 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
991417097 5:66404587-66404609 GTCATCCTTTGGAGGAGGAGAGG + Intergenic
992016325 5:72578391-72578413 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
992525900 5:77609749-77609771 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
993114223 5:83700450-83700472 GTGTCCATGGTGAGGATGAGAGG - Intronic
993758565 5:91763091-91763113 GCCTTCCTTTGGAGGAGGAGAGG - Intergenic
993798660 5:92302019-92302041 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
994274093 5:97814965-97814987 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
995180311 5:109224646-109224668 CTCGCCCTGGGGAGAGGGAGAGG + Intergenic
995529042 5:113074471-113074493 GTCTTCCTTTGGAGGAGAAGAGG - Intronic
995570097 5:113471224-113471246 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
996455758 5:123679607-123679629 GTGTCCCTTTGGAGGAGGAGAGG + Intergenic
996477110 5:123934565-123934587 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
996674062 5:126154847-126154869 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
996935344 5:128942653-128942675 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
996956152 5:129186136-129186158 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
996988908 5:129604095-129604117 GGCTCGGTGGGGAGGAGGTGGGG + Intronic
997102831 5:130987668-130987690 TTCTCCCCAGGGAGGAGGAGGGG - Intergenic
997664601 5:135620038-135620060 GTGCCCCTGGGCAGCAGGAGTGG + Intergenic
997688800 5:135811208-135811230 TTCTCCCTGGGAAGGAGGATGGG + Intergenic
997808749 5:136946491-136946513 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
997823167 5:137084133-137084155 GTCTGCATGGGGTGGAGGTGGGG - Intronic
998142712 5:139709273-139709295 GCCTCCCCGGGGAGGGGAAGAGG - Intergenic
998850131 5:146344127-146344149 GTCTCCCTGGGAATGGGGATCGG + Intergenic
999064665 5:148673246-148673268 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
999149900 5:149420020-149420042 CCCTCCCTGGGGAGGAAGTGGGG + Intergenic
999358931 5:150965204-150965226 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
999548578 5:152659008-152659030 GTGTTCCTCTGGAGGAGGAGAGG + Intergenic
1000036978 5:157456400-157456422 GTCTCCCTGAGGAGGGTGGGTGG - Intronic
1000064712 5:157684564-157684586 GTGGCCCTGGAGAGGAGGAGGGG - Intergenic
1000082232 5:157859001-157859023 GGGTCCGTGGGGAGCAGGAGAGG - Exonic
1000404675 5:160874476-160874498 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1000424264 5:161072304-161072326 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1000544277 5:162579121-162579143 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1000775400 5:165413628-165413650 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1000932704 5:167271189-167271211 CTCTGCATGGTGAGGAGGAGTGG + Intergenic
1001090957 5:168740643-168740665 GTCTTCCTGGGGTGGAGGGTTGG - Intronic
1001262602 5:170244829-170244851 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1001380895 5:171305749-171305771 TTCTTCTTGGGGAAGAGGAGAGG + Intergenic
1002106211 5:176880568-176880590 GTGTCCCTGGGTGGGTGGAGAGG - Exonic
1002385119 5:178860471-178860493 GTGTCCCGAGGCAGGAGGAGTGG - Intronic
1002974960 6:2065365-2065387 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1003157636 6:3609660-3609682 TTCTCTCTGGGAAGGAGGAAGGG + Intergenic
1004294942 6:14401839-14401861 AGCTCCCTGGGGAGGCTGAGGGG - Intergenic
1004313960 6:14570346-14570368 GCCTCCCTGGGAAGGCTGAGAGG - Intergenic
1005239273 6:23804997-23805019 GCGTCCCTTTGGAGGAGGAGAGG - Intergenic
1005956207 6:30665215-30665237 GAGCCCCTGGGGAGGAGCAGCGG - Exonic
1006374602 6:33664974-33664996 GTGTCCCTGGGGTGGGGGTGGGG + Intronic
1006404879 6:33839085-33839107 GCCTGTCTGGGGAAGAGGAGTGG - Intergenic
1006452295 6:34112262-34112284 GCCTCCCTGGGGCGGGGGAGAGG - Intronic
1006475015 6:34247859-34247881 GGCTCCCTGGGAAGGAGGAAGGG + Exonic
1006603449 6:35240754-35240776 GTCTCACTGGTTGGGAGGAGTGG + Intronic
1006672095 6:35735864-35735886 ATATCCCTGGGGAGGCTGAGAGG + Intergenic
1006896139 6:37472310-37472332 GTCAGACTGGGGAGGAGGAATGG - Intronic
1006980687 6:38145494-38145516 GTCTACACAGGGAGGAGGAGTGG - Intronic
1007171276 6:39865213-39865235 GCCTCCCAGGAGAGGAGTAGGGG - Intronic
1007231290 6:40349225-40349247 TTCTTCCCTGGGAGGAGGAGAGG - Intergenic
1007327629 6:41073729-41073751 GTCTCCCTGGTGGGGAGAGGGGG + Intronic
1007415935 6:41691230-41691252 GGCTCCCTGTGGATGAGAAGGGG + Exonic
1007682602 6:43644954-43644976 GCCTCCGTGGGGAGGAGGTCTGG + Intergenic
1007858821 6:44885708-44885730 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1008239986 6:49098452-49098474 GCGTTCCTGTGGAGGAGGAGAGG - Intergenic
1008349990 6:50478602-50478624 GTGTTCCTCTGGAGGAGGAGAGG - Intergenic
1008491923 6:52095997-52096019 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1008635296 6:53405119-53405141 GTGTTCCTTTGGAGGAGGAGGGG + Intergenic
1008769586 6:54962378-54962400 GCCTTCCTTTGGAGGAGGAGAGG - Intergenic
1008898758 6:56587003-56587025 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1008999964 6:57701490-57701512 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1009188437 6:60600907-60600929 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1009282534 6:61770278-61770300 GCCTTCCTTTGGAGGAGGAGAGG - Intronic
1009322868 6:62313151-62313173 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1009410504 6:63360704-63360726 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1009613115 6:65972084-65972106 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1009829645 6:68913635-68913657 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1010105530 6:72163434-72163456 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1010441898 6:75904777-75904799 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1010540534 6:77087525-77087547 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1010589797 6:77699628-77699650 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1010695816 6:78972470-78972492 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1010834747 6:80572969-80572991 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1010854501 6:80821174-80821196 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1011004884 6:82633194-82633216 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1011188064 6:84700415-84700437 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1011302992 6:85896020-85896042 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1011376626 6:86694426-86694448 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1011743646 6:90387996-90388018 CACTCCCTGGGAAGGAGGAGGGG - Intergenic
1011795030 6:90943598-90943620 GTCTCTATGTGGTGGAGGAGAGG + Intergenic
1011978813 6:93344909-93344931 GCCTCTCCGGGGAAGAGGAGTGG - Intronic
1012089441 6:94873332-94873354 GTGTTCCTTCGGAGGAGGAGAGG + Intergenic
1012561376 6:100585629-100585651 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1012963427 6:105646958-105646980 CTCTCACTGGGTAGCAGGAGAGG + Intergenic
1013267539 6:108514205-108514227 GCCTTCCTTTGGAGGAGGAGAGG - Intronic
1013315375 6:108937289-108937311 GTCACCTTGGGGTGGGGGAGGGG + Intronic
1013344806 6:109250274-109250296 GTGTTCCTCTGGAGGAGGAGAGG + Intergenic
1013378159 6:109539652-109539674 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1013673975 6:112436476-112436498 GTCACCCAAAGGAGGAGGAGAGG + Intergenic
1013874273 6:114804958-114804980 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1014001459 6:116370730-116370752 GAGTCCCGGGAGAGGAGGAGCGG + Intronic
1014132897 6:117854892-117854914 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1014145806 6:117996866-117996888 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1014258004 6:119183633-119183655 GTTTCCATGGAGAGGAGGAGTGG - Intronic
1014565566 6:122944452-122944474 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1014702858 6:124711868-124711890 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1014732864 6:125054333-125054355 GGCTCCATGGGGAGCAGGAAGGG + Intronic
1014830318 6:126095649-126095671 GTCTACTTGGGTTGGAGGAGGGG + Intergenic
1014881321 6:126727338-126727360 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1014960080 6:127672466-127672488 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1014979320 6:127927278-127927300 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1015191483 6:130476598-130476620 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1015899589 6:138051206-138051228 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1016245069 6:141970609-141970631 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1016365043 6:143307250-143307272 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1017000912 6:149996417-149996439 GGCTGCCTGCAGAGGAGGAGGGG + Intergenic
1017978483 6:159377838-159377860 GGCTCCCTGGGGACCAGCAGAGG + Intergenic
1018455266 6:163946095-163946117 GGCTCCCTGAGGAGGAGCTGGGG + Intergenic
1018586757 6:165369171-165369193 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1018690337 6:166339306-166339328 GTTTCTCTAGGGAGGAGGAAGGG - Intronic
1019124822 6:169831099-169831121 CCCACCCTCGGGAGGAGGAGGGG + Intergenic
1019142685 6:169957939-169957961 GCCTCCCTGGGGAGGGGCAGTGG - Intergenic
1019273689 7:164779-164801 GTCTCTGTGGGGAGGAACAGGGG - Intergenic
1019565197 7:1675611-1675633 GGCTTCCTGGGGCCGAGGAGCGG + Intergenic
1019750040 7:2723555-2723577 GTCGGACTGAGGAGGAGGAGGGG + Intronic
1020330255 7:7010852-7010874 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1020486890 7:8731390-8731412 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1020980037 7:15055513-15055535 GGTTCCCTGAGGAGTAGGAGGGG - Intergenic
1021252429 7:18347366-18347388 GACTCCCTGGGGAGGCTTAGGGG + Intronic
1022079648 7:27007494-27007516 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1022473462 7:30695396-30695418 GCCTCCCGGGGGAGCTGGAGGGG - Intronic
1022576848 7:31506250-31506272 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1022654845 7:32308841-32308863 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1022672164 7:32465492-32465514 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1022874516 7:34514411-34514433 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1022934001 7:35152892-35152914 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1023084586 7:36558034-36558056 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1023818266 7:43966223-43966245 GCCTGCCGGGGGAGGAGGGGGGG + Intergenic
1024072209 7:45795839-45795861 GACTCCCAGAGGAGAAGGAGTGG + Intergenic
1024249316 7:47494481-47494503 GTCTTTCAGGGGAGGTGGAGTGG - Intronic
1024694200 7:51838511-51838533 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1024699454 7:51890864-51890886 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1024914621 7:54485303-54485325 GTCACCCTTGGGAGGAGGTGGGG - Intergenic
1025153917 7:56585747-56585769 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1026987256 7:74562272-74562294 GTGTCCCAGGGCAGGTGGAGGGG + Intronic
1027188780 7:75986320-75986342 GCATCCCTGGGCAGGAAGAGGGG - Exonic
1027235068 7:76293212-76293234 GCCTCCTTGGGTAGGTGGAGGGG - Intergenic
1027268196 7:76505353-76505375 ACCTGCCCGGGGAGGAGGAGGGG - Exonic
1027276824 7:76566242-76566264 GCCTTCCTTGGGAGGAGGAGAGG + Intergenic
1027292528 7:76729438-76729460 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1027874217 7:83748797-83748819 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1027892443 7:83994365-83994387 GCGTTCCTTGGGAGGAGGAGAGG + Intronic
1027983069 7:85250812-85250834 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1028065307 7:86376446-86376468 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1028355518 7:89901940-89901962 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1028468079 7:91174399-91174421 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1028507998 7:91590734-91590756 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1028665877 7:93342925-93342947 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1029113250 7:98223980-98224002 GTCTCCCTGGGGAAGGGGGTCGG + Intronic
1029199316 7:98827987-98828009 GTACACCTGGAGAGGAGGAGAGG - Intergenic
1029325327 7:99802668-99802690 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1029742896 7:102501055-102501077 GCCTGCCGGGGGAGGAGGGGGGG + Intronic
1029760886 7:102600216-102600238 GCCTGCCGGGGGAGGAGGGGGGG + Intronic
1030451690 7:109720199-109720221 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1030476070 7:110035177-110035199 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1031024191 7:116662627-116662649 CTCTCCCTGGGGAGGCTGACAGG - Intergenic
1031721367 7:125181002-125181024 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1032194417 7:129780931-129780953 GGCTCCCTCGGGAGGGGGCGGGG + Intergenic
1032391265 7:131556687-131556709 GGCTCCTGGGGGAGGGGGAGGGG - Intronic
1032458497 7:132092371-132092393 GACTCCATGGTGAGGAGCAGAGG - Intergenic
1032864623 7:135913572-135913594 GGTTCCCTGTGAAGGAGGAGAGG + Intergenic
1033631719 7:143165256-143165278 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1033661694 7:143407480-143407502 GTCTCCTCAGGGAGGGGGAGAGG - Intronic
1034135799 7:148768190-148768212 GTAGCCCTGGGGAAGCGGAGGGG - Intronic
1034432194 7:151046621-151046643 GTTCCCCTGGGCAGGAGAAGAGG + Intronic
1034482218 7:151330972-151330994 CTCTCCCTGGAGAGAAAGAGAGG - Intergenic
1035042192 7:155937077-155937099 TTCCCCCTGGGAAGGATGAGGGG - Intergenic
1035570037 8:666777-666799 GTCACCGCGAGGAGGAGGAGGGG - Intronic
1035739185 8:1913270-1913292 TTCTCCCTGGGAAGGATGGGCGG - Intronic
1035769834 8:2138314-2138336 GGCTGCCTGGGGAGCAGGAGAGG - Intronic
1035884326 8:3275978-3276000 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1035886122 8:3293877-3293899 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1036139354 8:6192159-6192181 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1036210096 8:6834669-6834691 GAGTCCCTGGGGTGGAAGAGGGG - Intronic
1036484318 8:9165676-9165698 GCTTCCCCTGGGAGGAGGAGAGG - Intronic
1036628865 8:10496461-10496483 GTCTCCCTGGGAATGAGGAAAGG + Intergenic
1036752717 8:11453573-11453595 AGCTCCCTGTGGAGGTGGAGGGG + Intronic
1036817160 8:11910719-11910741 ATTTCCCTGGGCAGGTGGAGCGG + Intergenic
1036965216 8:13289695-13289717 TTAGCCCTGGGGAGGAGAAGGGG + Intronic
1037763093 8:21755300-21755322 CTGTGCCTGGGGAGGAGTAGCGG + Intronic
1038094626 8:24294064-24294086 GTCTCACTGGAGAGGAGGCAGGG + Exonic
1039112568 8:34055858-34055880 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1039300084 8:36200297-36200319 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1039319491 8:36413167-36413189 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1039433728 8:37545517-37545539 GGCTCCCTGGGAAGGAAGCGAGG - Intergenic
1040076973 8:43246685-43246707 GTCTCCCTGCGGCGGAGGAGCGG + Intergenic
1040099098 8:43481136-43481158 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1040111944 8:43570551-43570573 GTCCCCCTGGGGATGAGGACAGG - Intergenic
1040112061 8:43570985-43571007 GTCTCCCAGGGGATGGGGACAGG - Intergenic
1040273536 8:45985071-45985093 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1040363793 8:46692874-46692896 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1040368459 8:46744930-46744952 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1040373365 8:46798402-46798424 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1040423204 8:47260085-47260107 GTTGGCCTGGGGAGGAGGAAAGG - Intergenic
1040427340 8:47302494-47302516 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1040428877 8:47318036-47318058 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1040446858 8:47504684-47504706 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1040451619 8:47553801-47553823 GTCTTCCTTTGGAGGAGAAGAGG + Intronic
1040814543 8:51493375-51493397 GCCTTCCTTTGGAGGAGGAGAGG - Intronic
1041044360 8:53877477-53877499 GTCTCGCTCGGGAGGAGGACAGG - Intronic
1041123047 8:54607093-54607115 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1041329940 8:56713925-56713947 CCTTCCCTGGGAAGGAGGAGGGG - Intergenic
1041362151 8:57065784-57065806 TCCTTCCTGGGGAGGAGGAGAGG - Intergenic
1041557403 8:59173709-59173731 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1041637645 8:60161448-60161470 GCATCCCTTTGGAGGAGGAGAGG - Intergenic
1042072975 8:64956641-64956663 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1042087195 8:65121593-65121615 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1042332437 8:67594929-67594951 GTGTTCCTTTGGAGGAGGAGGGG + Intronic
1043397286 8:79851369-79851391 ATGTGCCTGGGGAGGAAGAGAGG - Intergenic
1043547391 8:81330903-81330925 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1043757326 8:84019887-84019909 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1043791128 8:84469192-84469214 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1044135916 8:88585003-88585025 GTCTCCCTTGGCTGGAGGTGGGG + Intergenic
1044211576 8:89557388-89557410 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1044440742 8:92221116-92221138 GTGTCCCTTTGGAGGAGAAGAGG + Intergenic
1044572432 8:93734554-93734576 GGCACCCTAGGGAGGAGGACTGG - Exonic
1044816437 8:96117626-96117648 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1045088302 8:98711227-98711249 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1045322656 8:101093551-101093573 GACTCCCTGCAGAGGATGAGGGG + Intergenic
1045419630 8:102000968-102000990 GTATTCCTTTGGAGGAGGAGAGG - Intronic
1045571777 8:103375064-103375086 TTCTCCTTGGGGAAGAGGGGTGG + Intronic
1045647808 8:104316514-104316536 CTCTCCCTGGAGAGGAGTAGGGG + Intergenic
1046007594 8:108505346-108505368 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1046081477 8:109375550-109375572 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1046433980 8:114163685-114163707 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1047203580 8:122785769-122785791 GGTACCCTGGGGAGGTGGAGAGG + Intronic
1047248600 8:123165394-123165416 GTCTCCCTGAGGGTGAGGACCGG + Intergenic
1047381980 8:124372453-124372475 GCCTCCCGGCTGAGGAGGAGCGG + Exonic
1047833990 8:128667979-128668001 GCCACCCTGGGGAGAAGGAAGGG - Intergenic
1047837674 8:128712129-128712151 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1047838031 8:128715316-128715338 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1047854612 8:128896544-128896566 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1047917075 8:129593898-129593920 GGGTCCCAGGGGAGGAGGGGAGG - Intergenic
1048093248 8:131263189-131263211 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1048126013 8:131636123-131636145 GCCTTCCTTTGGAGGAGGAGAGG - Intergenic
1048540403 8:135336475-135336497 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1048792592 8:138117119-138117141 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1049074500 8:140383255-140383277 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1049424503 8:142532130-142532152 CTCCCCCTGTGTAGGAGGAGGGG + Intronic
1049683417 8:143929891-143929913 GGCTCTCTGGGTGGGAGGAGGGG - Intronic
1049830897 8:144700245-144700267 GGCTCCCTCAGGAGAAGGAGCGG - Intergenic
1050395232 9:5188419-5188441 CCCTGCCTGGTGAGGAGGAGTGG + Intergenic
1050418312 9:5437159-5437181 GTATTTCTGGGGAGGAGAAGTGG + Intronic
1050490338 9:6182261-6182283 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1050534265 9:6618284-6618306 GTCTAACTGTGGAGGAGGAAAGG - Intronic
1051336923 9:16074058-16074080 GTATCACTGGGCTGGAGGAGAGG + Intergenic
1051479179 9:17540516-17540538 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1051739136 9:20234775-20234797 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1051853575 9:21536878-21536900 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1052009935 9:23395709-23395731 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1052082928 9:24229697-24229719 GCCTTCCTTTGGAGGAGGAGAGG + Intergenic
1052145613 9:25045014-25045036 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1052148110 9:25075993-25076015 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1052254447 9:26437689-26437711 GTGTTCCTGGGGTGGAGGAGAGG - Intergenic
1052513544 9:29451477-29451499 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1052562828 9:30107821-30107843 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1052627997 9:31002378-31002400 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1052773615 9:32711332-32711354 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1053503381 9:38620813-38620835 ATCTCTCTTCGGAGGAGGAGCGG - Intergenic
1053656580 9:40222909-40222931 ATCTCCCTTCTGAGGAGGAGCGG + Intergenic
1053714646 9:40874544-40874566 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1053886438 9:42647507-42647529 GTTTCCCTGCGGAAGAGGGGAGG + Intergenic
1053906934 9:42852131-42852153 ATCTCCCTTCCGAGGAGGAGCGG + Intergenic
1054225457 9:62454956-62454978 GTTTCCCTGCGGAAGAGGGGAGG + Intergenic
1054356999 9:64071356-64071378 ATCTCCCTTCCGAGGAGGAGCGG + Intergenic
1054368684 9:64369131-64369153 ATCTCCCTTCCGAGGAGGAGCGG + Intergenic
1054528035 9:66153376-66153398 ATCTCCCTTCCGAGGAGGAGCGG - Intergenic
1054676313 9:67858883-67858905 ATCTCCCTTCTGAGGAGGAGCGG + Intergenic
1054889461 9:70235089-70235111 GCCTTCCTTTGGAGGAGGAGAGG - Intergenic
1055476112 9:76665427-76665449 GACTCTGTGGGGAGGAGGTGAGG - Intronic
1055476898 9:76670995-76671017 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1055616281 9:78076044-78076066 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1055721688 9:79182336-79182358 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1056051485 9:82774396-82774418 GTGTTCCTCTGGAGGAGGAGAGG + Intergenic
1056173877 9:84015130-84015152 GTCTCCCTGGGGAGCAGAATAGG - Intergenic
1056393320 9:86158043-86158065 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1056416529 9:86382521-86382543 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1056861973 9:90193266-90193288 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1056919562 9:90774290-90774312 GTCTGCCTAGGGATGAGGAGGGG + Intergenic
1057086528 9:92215364-92215386 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1057152575 9:92808461-92808483 ATCTCCCTCCGGTGGAGGAGTGG + Intergenic
1057152753 9:92809097-92809119 ATCTCTCTTTGGAGGAGGAGCGG + Intergenic
1057231424 9:93323916-93323938 GTCTCCATGGAGAGGGGGAGAGG - Intronic
1057236672 9:93366707-93366729 GTCTCCATGGAGAGGAGGAGAGG + Intergenic
1057324612 9:94050263-94050285 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1057684695 9:97221781-97221803 ATCTCTCTTCGGAGGAGGAGAGG - Intergenic
1057844222 9:98509362-98509384 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1058063968 9:100528183-100528205 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1058134513 9:101291883-101291905 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1058192892 9:101940455-101940477 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1058209736 9:102152795-102152817 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1058525130 9:105850000-105850022 GTCTTCCTGGGGCGGCGGGGAGG + Intergenic
1059384161 9:113950970-113950992 ATGTCTCTGAGGAGGAGGAGTGG + Intronic
1059386344 9:113967745-113967767 TTCTCCCTGGGGAGCAAGTGTGG + Intronic
1059633518 9:116150726-116150748 GAGTCCCTGGGGAGGAGGGCTGG + Intergenic
1059768254 9:117403908-117403930 GCCTTGCTGGGGAGGAGGGGAGG + Intronic
1060306073 9:122413675-122413697 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1060482729 9:124026858-124026880 GCTTCCCTGAGGAGGAGGTGTGG + Intronic
1060617770 9:125034283-125034305 GTCTCCCAGGGTAGGAGAAGAGG + Intronic
1060932559 9:127498015-127498037 GCCTCCCTGGGGAAGAGGTGAGG + Intronic
1060980475 9:127788731-127788753 GTCCCCCGGCAGAGGAGGAGTGG + Intronic
1060998355 9:127887586-127887608 TTCTCCCTGGGGATGGAGAGGGG + Exonic
1061083395 9:128385613-128385635 GGCGCCCAGGGGAGGAGGAAGGG - Intronic
1061449165 9:130659472-130659494 GGCGCCCAGGGGCGGAGGAGGGG - Intergenic
1061623658 9:131827767-131827789 GGCAGCCTGGGGAGCAGGAGCGG + Intergenic
1061780681 9:132994454-132994476 GTCCTCCTGGACAGGAGGAGAGG - Intergenic
1061946797 9:133913100-133913122 AGCTCCCTGGAGAGGAAGAGGGG - Intronic
1062040026 9:134400295-134400317 GTCTTCCTGGGGCTGGGGAGGGG + Intronic
1062096367 9:134706022-134706044 CTCTGCCAGGGGAGGAGGACAGG - Intronic
1062140887 9:134958308-134958330 GTCACCCAGGGGTGGAGGAAGGG - Intergenic
1062176760 9:135167670-135167692 GACTCCCTGGGCAGGGGAAGAGG + Intergenic
1062379483 9:136280396-136280418 GTCTCCCAGGGGAGGGGCCGGGG + Intergenic
1062429350 9:136520087-136520109 GGCAGCCTGTGGAGGAGGAGGGG - Intronic
1062598745 9:137310815-137310837 AGCACCCTGGGGAGGAGGTGGGG + Intronic
1203696982 Un_GL000214v1:108666-108688 ATCTCTCTTCGGAGGAGGAGAGG - Intergenic
1203697152 Un_GL000214v1:109276-109298 ATCTCCCTCAGGTGGAGGAGTGG - Intergenic
1203748538 Un_GL000218v1:58095-58117 ATCTCCCTTCCGAGGAGGAGCGG + Intergenic
1203440966 Un_GL000219v1:8428-8450 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1203394650 Un_KI270512v1:14481-14503 GCCTTCCTTTGGAGGAGGAGAGG + Intergenic
1203552062 Un_KI270743v1:171753-171775 ATCTCCCTCAGGTGGAGGAGTGG + Intergenic
1203552232 Un_KI270743v1:172363-172385 ATCTCTCTTCGGAGGAGGAGAGG + Intergenic
1203561182 Un_KI270744v1:59925-59947 ATCTCCCTTCCGAGGAGGAGCGG - Intergenic
1185485416 X:478159-478181 GAGTCCCTGGGGTGCAGGAGAGG + Intergenic
1186041262 X:5481400-5481422 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1186288241 X:8068853-8068875 GTGTCCAAGGGCAGGAGGAGTGG - Intergenic
1186795511 X:13043948-13043970 GTCTCCCGTGGGAGCAGGAGGGG + Intronic
1187113245 X:16322728-16322750 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1187130571 X:16498437-16498459 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1188075502 X:25771375-25771397 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1188658702 X:32731854-32731876 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1189037513 X:37507321-37507343 GTGTCCCCGGGGTGGAGGAGCGG + Intronic
1189049842 X:37633478-37633500 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1189070640 X:37860340-37860362 ATCTCCCTGGGGTGGAGGTGGGG - Intronic
1189659020 X:43277990-43278012 GTCTCCCTGGAAAGGAGCTGGGG + Intergenic
1189970598 X:46414939-46414961 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1190271636 X:48868755-48868777 GTGTTCCTCTGGAGGAGGAGAGG + Intergenic
1190287325 X:48970276-48970298 GTCTCCCTGGGCTTGGGGAGTGG - Exonic
1190404632 X:50074371-50074393 CTGACTCTGGGGAGGAGGAGAGG + Intronic
1190422638 X:50301183-50301205 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1190590559 X:51996351-51996373 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1190608741 X:52171857-52171879 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1190807549 X:53853496-53853518 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1190907083 X:54738150-54738172 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1190921628 X:54858984-54859006 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1190962978 X:55270173-55270195 GCCTTCCTTTGGAGGAGGAGAGG - Intronic
1191070289 X:56393787-56393809 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1191087623 X:56586570-56586592 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1191134605 X:57049989-57050011 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1191203500 X:57810070-57810092 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1191635224 X:63368506-63368528 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1191687138 X:63903723-63903745 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1191709712 X:64136932-64136954 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1191747155 X:64502260-64502282 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1191938792 X:66454916-66454938 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1192096566 X:68217871-68217893 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1192280669 X:69681871-69681893 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1192293950 X:69827749-69827771 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1192366860 X:70480849-70480871 CTCTGCCTGGGCAGGGGGAGTGG + Intronic
1192599025 X:72441627-72441649 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1192683823 X:73282440-73282462 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1192685856 X:73304679-73304701 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1192854899 X:74999056-74999078 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1192974500 X:76268361-76268383 GCCTTCCTTTGGAGGAGGAGAGG - Intergenic
1192979816 X:76327840-76327862 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1193391819 X:80937647-80937669 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1193785592 X:85756761-85756783 GCATTCCTGTGGAGGAGGAGAGG + Intergenic
1193922629 X:87448166-87448188 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1194191073 X:90837300-90837322 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1194255448 X:91628182-91628204 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1194570412 X:95548934-95548956 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1194813604 X:98416074-98416096 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1194814831 X:98429380-98429402 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1194826126 X:98565139-98565161 GTCTTCCTTTGGAGGAGGAGAGG + Intergenic
1194879694 X:99235690-99235712 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1194887284 X:99332313-99332335 GTCTTTCTGGGGAGGATGATCGG - Intergenic
1195024862 X:100866520-100866542 GTATCTCTGGGGAGTAGGATGGG + Intronic
1195088876 X:101440026-101440048 GTGTTCCTTTGGAGGAGGAGAGG + Intronic
1195147579 X:102032517-102032539 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1195233594 X:102876224-102876246 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1195294149 X:103459596-103459618 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1195395678 X:104408283-104408305 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1195553469 X:106194590-106194612 GTGTTCCTTCGGAGGAGGAGAGG + Intronic
1195659709 X:107365293-107365315 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1195832186 X:109071674-109071696 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1196249732 X:113446394-113446416 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1196268903 X:113687518-113687540 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1196511688 X:116519658-116519680 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1196546472 X:116969865-116969887 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1196597013 X:117556752-117556774 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1196626109 X:117879050-117879072 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1196901661 X:120390122-120390144 GCATTCCTGTGGAGGAGGAGAGG + Intergenic
1197389238 X:125839941-125839963 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1197417240 X:126190273-126190295 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1197452543 X:126637956-126637978 CTCTCACTGGGGTGGAGGAAGGG - Intergenic
1197619710 X:128733822-128733844 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1197624199 X:128783608-128783630 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1197811895 X:130452558-130452580 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1197972938 X:132133712-132133734 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1197984029 X:132249076-132249098 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1198057680 X:133010757-133010779 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1198127235 X:133657600-133657622 CTCTGCCTTGGAAGGAGGAGGGG + Intronic
1198474400 X:136982172-136982194 GTATTCCTTTGGAGGAGGAGAGG + Intergenic
1198553421 X:137768365-137768387 GTATTCCTTTGGAGGAGGAGAGG + Intergenic
1198980549 X:142390646-142390668 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1199668211 X:150118961-150118983 TTCTCCCTGGGGTGGGGGTGGGG + Intergenic
1200122516 X:153797845-153797867 CTGTCCCTGGGGAGCAGGATGGG + Intronic
1200141282 X:153904250-153904272 CCCTAACTGGGGAGGAGGAGGGG + Intronic
1200357716 X:155568927-155568949 GTGTTCCTTTGGAGGAGGAGAGG - Intronic
1200426918 Y:3031895-3031917 GTGTTCCTTTGGAGGAGGAGTGG + Intergenic
1200537727 Y:4419723-4419745 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1200879214 Y:8194544-8194566 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1201153339 Y:11107323-11107345 ATCTCCCTCAGGTGGAGGAGTGG + Intergenic
1201189641 Y:11435995-11436017 CACTCCTTGGGGAGCAGGAGAGG - Intergenic
1201425905 Y:13850976-13850998 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1201519970 Y:14862182-14862204 GTATTCCTTTGGAGGAGGAGAGG - Intergenic
1201635991 Y:16124061-16124083 GTCTCCCTGGGGTGGAAGTAGGG - Intergenic
1201787988 Y:17806748-17806770 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1201813565 Y:18099240-18099262 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1202298254 Y:23383484-23383506 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1202331461 Y:23757358-23757380 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1202344287 Y:23905416-23905438 GTTTTCCTTTGGAGGAGGAGAGG + Intergenic
1202383401 Y:24299465-24299487 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1202487383 Y:25370656-25370678 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1202526481 Y:25764667-25764689 GTTTTCCTTTGGAGGAGGAGAGG - Intergenic
1202539309 Y:25912702-25912724 GTGTTCCTTTGGAGGAGGAGAGG + Intergenic
1202572555 Y:26287115-26287137 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic
1202602019 Y:26602856-26602878 GTGTTCCTTTGGAGGAGGAGAGG - Intergenic