ID: 968551620

View in Genome Browser
Species Human (GRCh38)
Location 4:1226343-1226365
Sequence CCTGGGGAGGAGGAGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3280
Summary {0: 1, 1: 4, 2: 39, 3: 368, 4: 2868}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968551598_968551620 28 Left 968551598 4:1226292-1226314 CCCACCCCATCCGGATGATTGCA 0: 1
1: 0
2: 0
3: 5
4: 84
Right 968551620 4:1226343-1226365 CCTGGGGAGGAGGAGGGGGCAGG 0: 1
1: 4
2: 39
3: 368
4: 2868
968551603_968551620 18 Left 968551603 4:1226302-1226324 CCGGATGATTGCATTCCTGTGTC 0: 1
1: 0
2: 2
3: 9
4: 144
Right 968551620 4:1226343-1226365 CCTGGGGAGGAGGAGGGGGCAGG 0: 1
1: 4
2: 39
3: 368
4: 2868
968551601_968551620 23 Left 968551601 4:1226297-1226319 CCCATCCGGATGATTGCATTCCT 0: 1
1: 0
2: 0
3: 5
4: 284
Right 968551620 4:1226343-1226365 CCTGGGGAGGAGGAGGGGGCAGG 0: 1
1: 4
2: 39
3: 368
4: 2868
968551606_968551620 -4 Left 968551606 4:1226324-1226346 CCGACTGGCCATCCGTCTCCCTG 0: 1
1: 0
2: 1
3: 15
4: 166
Right 968551620 4:1226343-1226365 CCTGGGGAGGAGGAGGGGGCAGG 0: 1
1: 4
2: 39
3: 368
4: 2868
968551605_968551620 3 Left 968551605 4:1226317-1226339 CCTGTGTCCGACTGGCCATCCGT 0: 1
1: 0
2: 0
3: 2
4: 32
Right 968551620 4:1226343-1226365 CCTGGGGAGGAGGAGGGGGCAGG 0: 1
1: 4
2: 39
3: 368
4: 2868
968551600_968551620 24 Left 968551600 4:1226296-1226318 CCCCATCCGGATGATTGCATTCC 0: 1
1: 0
2: 4
3: 46
4: 187
Right 968551620 4:1226343-1226365 CCTGGGGAGGAGGAGGGGGCAGG 0: 1
1: 4
2: 39
3: 368
4: 2868
968551599_968551620 27 Left 968551599 4:1226293-1226315 CCACCCCATCCGGATGATTGCAT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 968551620 4:1226343-1226365 CCTGGGGAGGAGGAGGGGGCAGG 0: 1
1: 4
2: 39
3: 368
4: 2868
968551602_968551620 22 Left 968551602 4:1226298-1226320 CCATCCGGATGATTGCATTCCTG 0: 1
1: 0
2: 0
3: 4
4: 105
Right 968551620 4:1226343-1226365 CCTGGGGAGGAGGAGGGGGCAGG 0: 1
1: 4
2: 39
3: 368
4: 2868

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968551620 Original CRISPR CCTGGGGAGGAGGAGGGGGC AGG Intronic
Too many off-targets to display for this crispr