ID: 968556095

View in Genome Browser
Species Human (GRCh38)
Location 4:1247271-1247293
Sequence TGGCATCTGGTCACTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968556095_968556110 25 Left 968556095 4:1247271-1247293 CCCCCAGGAGTGACCAGATGCCA 0: 1
1: 0
2: 1
3: 19
4: 170
Right 968556110 4:1247319-1247341 CTCTGCAGAGGACGCCTGTATGG No data
968556095_968556105 13 Left 968556095 4:1247271-1247293 CCCCCAGGAGTGACCAGATGCCA 0: 1
1: 0
2: 1
3: 19
4: 170
Right 968556105 4:1247307-1247329 TCCCTCCCAGAGCTCTGCAGAGG 0: 1
1: 0
2: 3
3: 49
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968556095 Original CRISPR TGGCATCTGGTCACTCCTGG GGG (reversed) Intronic
900915558 1:5635694-5635716 TGGGATTTCCTCACTCCTGGTGG + Intergenic
903379126 1:22884791-22884813 TGGCATCTGGGCAGTGATGGAGG - Intronic
904715759 1:32466299-32466321 TGGCATCTGCTGTCTCCTGGAGG + Intronic
908930880 1:69315118-69315140 TGGCATCTGGGCACTCCTCCAGG - Intergenic
909615582 1:77605185-77605207 TGCCTTGTGGTCACTGCTGGGGG - Intronic
909902965 1:81160872-81160894 TGCCATGTGGCCACTGCTGGGGG - Intergenic
911163123 1:94701301-94701323 TGATATCTGGTGACTCCTGGAGG + Intergenic
913700453 1:121369029-121369051 GGGCAGCTGGCCACTCATGGCGG - Intronic
914041004 1:144049487-144049509 GGGCAGCTGGCCACTCATGGCGG - Intergenic
914137084 1:144910989-144911011 GGGCAGCTGGCCACTCATGGCGG + Intronic
915516180 1:156413892-156413914 TGGCCTCTGGAGACTCCTTGTGG + Intronic
919043737 1:192425004-192425026 TGGCATCTGTGCACTCCTCCCGG + Intergenic
919737829 1:200964519-200964541 TGGCCTATGTTCACTCCTTGGGG - Intergenic
920487869 1:206387756-206387778 GGGCAGCTGGCCACTCATGGCGG - Intronic
923338532 1:232989706-232989728 TGGCATCTGGTCAGTTTTGCAGG - Intronic
1063488330 10:6440617-6440639 TGGCAGCTGCTCACTACTGGAGG - Intronic
1065955168 10:30687432-30687454 TGAGAGGTGGTCACTCCTGGTGG - Intergenic
1066360070 10:34721534-34721556 TGGATGCTGGGCACTCCTGGGGG - Intronic
1067140832 10:43655316-43655338 TGGGACCTGGACACTCCAGGTGG + Intergenic
1067551811 10:47241695-47241717 CCGCATCTTGTCACTCCTGAGGG - Intergenic
1069367235 10:67706582-67706604 GGACATCTGGTCAGTGCTGGGGG + Intergenic
1069905270 10:71728547-71728569 TGGCATCTGGTCACTGCCTCTGG - Intronic
1069981346 10:72255072-72255094 GGGCATCTGGCCCCTTCTGGAGG - Intergenic
1070614420 10:77958538-77958560 TAGCCTCTGGCCACTCCTGGGGG + Intergenic
1071010762 10:80937828-80937850 TGCTCTCTGGTCACTCCTGTTGG + Intergenic
1071815858 10:89232310-89232332 TAGCTCCTGATCACTCCTGGTGG - Intronic
1076321988 10:129589868-129589890 TGTCTTCTGGACCCTCCTGGTGG - Intronic
1077450957 11:2645287-2645309 TGGCACCTGAGCACTCCTGGGGG - Intronic
1080415596 11:32067296-32067318 TGGAATCTGGTATCTCCTAGGGG - Intronic
1081574618 11:44311209-44311231 TGTCACCTGTTCACTCCTTGGGG + Intergenic
1084957958 11:72701594-72701616 TGGCATCTGGTCACGGCTGCAGG - Intronic
1084981555 11:72831632-72831654 AGGCAGCTGGTGACCCCTGGTGG - Intronic
1085905048 11:80750203-80750225 TGGGATCTGGTAATACCTGGTGG - Intergenic
1086123492 11:83326253-83326275 TGGCACCTGAGCACTCCTGCTGG - Intergenic
1087174445 11:95083102-95083124 AGTCATCTAGTCACTGCTGGTGG + Intergenic
1087211161 11:95447272-95447294 TGGCATCTCTGCACTCTTGGGGG - Intergenic
1087992206 11:104758613-104758635 TGGCATCTGTTCATTCCTCCTGG + Intergenic
1089296002 11:117468677-117468699 GGGCAGCTGGTCCTTCCTGGGGG - Intronic
1090251164 11:125252826-125252848 TGGCATCAGCTCACTCCTTCAGG + Intronic
1093619879 12:21276688-21276710 TGCCATGTGGCCACTGCTGGGGG - Intronic
1093782450 12:23152363-23152385 TGGCAGCTGAGCACTTCTGGAGG - Intergenic
1097357313 12:58616178-58616200 AGGCATCTGTTAAGTCCTGGAGG + Intronic
1097446579 12:59679101-59679123 TGGCATCTCTGCACTCTTGGGGG - Intronic
1103247885 12:119473616-119473638 TGGACTCTGGGGACTCCTGGGGG - Intronic
1103578080 12:121893607-121893629 TGGCCTCTGGTGACTGCTGGCGG + Intronic
1106253597 13:28002173-28002195 TGGCCTCTTCCCACTCCTGGTGG - Intergenic
1111572194 13:90103623-90103645 TGCCATATGGCCACTGCTGGGGG + Intergenic
1114576533 14:23719442-23719464 CACAATCTGGTCACTCCTGGTGG - Intergenic
1115643018 14:35347438-35347460 TGACCTCTGGTCACGCCTGTGGG - Intergenic
1119036071 14:71231362-71231384 AGGCATCTGTGCACTCCTGGGGG + Intergenic
1120867615 14:89309272-89309294 TGGCACGTGGCAACTCCTGGAGG - Intronic
1121683558 14:95814789-95814811 TGGCCACAGGTCACTCCTGGGGG - Intergenic
1121793874 14:96719950-96719972 GGGCAACTGGCCAGTCCTGGTGG - Intergenic
1122128968 14:99594120-99594142 TGGCACCTGGTCAGTCCTTCCGG + Intronic
1124091994 15:26614083-26614105 TGGCACCCTGTCACTACTGGAGG - Intronic
1124477264 15:30045571-30045593 TGGCTTCTAGCCACTCCAGGCGG - Intergenic
1124688304 15:31800577-31800599 TGTCCCCTGGTCACTCCTGGAGG + Intronic
1124704734 15:31954273-31954295 TGGCATGTGGCCACTCCATGGGG + Intergenic
1126252733 15:46588054-46588076 TGGCATCTGTACACTCCTCCTGG - Intergenic
1126319734 15:47409231-47409253 GGGCATATGTTCTCTCCTGGAGG + Intronic
1126839321 15:52701189-52701211 TGGCATATGGCCAGGCCTGGTGG + Intronic
1126987558 15:54330337-54330359 TGGCATGTGGTCATCCTTGGAGG + Intronic
1129070521 15:72946583-72946605 TGGCATCTGGACACTCCTCCTGG + Intergenic
1129098113 15:73231281-73231303 TAGCATGTGGTCTATCCTGGAGG - Intronic
1130834328 15:87634307-87634329 TGGCATTTGCTCCCTCCTGTAGG + Intergenic
1131315247 15:91329812-91329834 CGCCATGTGGTCACTGCTGGGGG + Intergenic
1131864394 15:96691874-96691896 TGGCATCAGTTCATTCCTGATGG + Intergenic
1133271648 16:4613535-4613557 TGGCTTCTAGTCCCTCCTGCAGG + Intronic
1135962069 16:27003331-27003353 TGGCCTCTGTTGACACCTGGTGG - Intergenic
1136654210 16:31700224-31700246 TGGCCTCTGGTCCCTTGTGGAGG - Intergenic
1137537466 16:49338174-49338196 TGGCATCTGCTGACCACTGGAGG + Intergenic
1138160440 16:54748263-54748285 TGGAACCTGGTCAGTGCTGGTGG - Intergenic
1138394735 16:56695386-56695408 AGGCATCCCTTCACTCCTGGGGG + Intronic
1139952840 16:70680338-70680360 CTGCATCTGGGCACACCTGGAGG - Intronic
1140412788 16:74751449-74751471 TGACAACTGGTGACGCCTGGTGG + Intronic
1141759459 16:86018261-86018283 GGGCTTCTGGATACTCCTGGAGG + Intergenic
1143010690 17:3864805-3864827 TGACATCTGCTCCCTGCTGGAGG - Intronic
1144578509 17:16444668-16444690 TGGCAGCTGCTGACTCCTGGAGG + Intronic
1144852579 17:18251462-18251484 GGGCATCTGCGCTCTCCTGGGGG + Exonic
1149362588 17:55910957-55910979 AGGCATCTCTGCACTCCTGGGGG - Intergenic
1149474346 17:56946976-56946998 TGCCTTCTGGTTTCTCCTGGGGG - Intronic
1149637410 17:58182030-58182052 TGTCAACTGGTCTCTCCTTGTGG + Intergenic
1150593627 17:66584645-66584667 TGGCCTCTTCCCACTCCTGGTGG + Intronic
1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG + Intronic
1164159981 19:22620097-22620119 TGGCATCTGGTATATCTTGGGGG + Intergenic
1166122180 19:40692497-40692519 TGGAAGCTGCTCACTCTTGGGGG - Intronic
1167765813 19:51481516-51481538 TGTCATCCGGTCACTACTAGAGG - Exonic
1168031817 19:53686102-53686124 TGGCCTGTGGTCTCTCCTGGAGG + Intergenic
1168032316 19:53690445-53690467 TAGCCTGTGGTCTCTCCTGGAGG + Intergenic
926196848 2:10769135-10769157 TGGCCTCCCGTCACCCCTGGGGG - Intronic
926249154 2:11143759-11143781 TGGCATCGGGTCACTCTTGGGGG + Intronic
927739118 2:25551424-25551446 TTGCAAGTGGTCAGTCCTGGAGG - Intronic
928916991 2:36482920-36482942 TGTCTTTTGGTTACTCCTGGAGG + Intronic
930055672 2:47250379-47250401 AAGCATCTGGACACTCCTTGGGG - Intergenic
937224332 2:120359656-120359678 TGGCTGCTGGTCATTCCTGTAGG + Intergenic
938063636 2:128269821-128269843 TGCCATCTGGGGAATCCTGGCGG - Intronic
940396506 2:153197118-153197140 TGGCATCTGGACATTCCTTCTGG - Intergenic
941343143 2:164332742-164332764 TGGCATTTGATCAATCCAGGTGG - Intergenic
944550140 2:200838268-200838290 TGGCATGTGGCCACTACTGGGGG - Intergenic
945083232 2:206106860-206106882 AGTCAACTGCTCACTCCTGGGGG - Intergenic
946374582 2:219300283-219300305 TGGCCTCTGGACAGTGCTGGGGG + Intronic
947009283 2:225547662-225547684 TGCCATGTGGCCACTGCTGGGGG + Intronic
947462543 2:230315808-230315830 TGCCCTCTGGTATCTCCTGGTGG + Intergenic
947471652 2:230406321-230406343 TGCCCTCTGGTATCTCCTGGTGG + Intergenic
948430793 2:237917460-237917482 TGGGAACAGGTCACTCCTGCCGG + Intergenic
948465833 2:238151190-238151212 TGCCGTCTGATCACCCCTGGTGG - Exonic
1169747199 20:8954350-8954372 TGGCTGAGGGTCACTCCTGGTGG - Intronic
1170620378 20:17990760-17990782 TGGCCTCTGGCTACTTCTGGGGG - Exonic
1172612087 20:36259973-36259995 TGTCAGCTGCTCACTACTGGGGG + Intronic
1174104917 20:48155267-48155289 GGGCATCTGTTCACGCCAGGAGG - Intergenic
1178690417 21:34745660-34745682 TGGGATTTGCTGACTCCTGGAGG - Intergenic
1179805318 21:43833563-43833585 TGGCATCTGGCCAGGCGTGGTGG - Intergenic
1183342389 22:37288722-37288744 GGGCATATGGTGCCTCCTGGAGG + Intronic
1184487980 22:44792589-44792611 TGACATCTAGTCACACCTGAAGG - Intronic
1184869332 22:47225376-47225398 TGGCATCTCCACACTTCTGGGGG - Intergenic
1184981515 22:48099154-48099176 TGTCCTCTGATCACACCTGGGGG - Intergenic
949336614 3:2981786-2981808 TGGCATCTGAGCACTTCGGGAGG + Intronic
949855686 3:8459020-8459042 TGTCATGTGATCACTCCAGGGGG - Intergenic
951616207 3:24547659-24547681 TTGCCTTTTGTCACTCCTGGAGG - Intergenic
952635823 3:35529403-35529425 AGGCATCTGGTCACACCTGAAGG + Intergenic
956269265 3:67432693-67432715 TGGCATATGGTAACAACTGGAGG - Intronic
958705464 3:97648860-97648882 TGTCATCAAGTCACTGCTGGTGG + Intronic
959863762 3:111243236-111243258 TGGCATCTCTGCACTCTTGGGGG - Intronic
962682485 3:137814814-137814836 TGGCCTCTGGTCAGAGCTGGAGG - Intergenic
964295527 3:155228854-155228876 TGTCAGCTGGTCTCTTCTGGAGG - Intergenic
964719678 3:159758739-159758761 TGCCAAATGGTCCCTCCTGGAGG + Intronic
965060259 3:163775612-163775634 TTTCATGTGGTCACTTCTGGAGG + Intergenic
965547958 3:169934565-169934587 TACCATGTGGTCACTTCTGGGGG - Intronic
967043709 3:185717362-185717384 AGGCATCTGTTCTGTCCTGGAGG - Exonic
968083666 3:195864103-195864125 GGGCATCTCCCCACTCCTGGTGG + Exonic
968556095 4:1247271-1247293 TGGCATCTGGTCACTCCTGGGGG - Intronic
969564562 4:7970443-7970465 TGGCATCAGGTCTTTGCTGGAGG + Intronic
976036261 4:80824920-80824942 TGACATCTGGTCACTCTTTCTGG - Intronic
983492997 4:168411366-168411388 TGCCATGTGGCCACTGCTGGAGG - Intronic
984690223 4:182717910-182717932 TGGGAGCTGCTCACTCCTGAAGG + Intronic
991011047 5:61883438-61883460 TGGCATCTATTCACTCCTCCAGG + Intergenic
992290546 5:75275007-75275029 TGGCATCTTCACACTTCTGGCGG + Intergenic
992496426 5:77298476-77298498 TAGCATGTGGGCACCCCTGGAGG + Intronic
992564971 5:77987476-77987498 TGTAGTCTGGTCACTCCTTGGGG - Intergenic
994190721 5:96866723-96866745 TGTCAGCAGGTCCCTCCTGGTGG - Intronic
995395099 5:111678795-111678817 TGGCATCTCCTTCCTCCTGGAGG - Intronic
997002922 5:129784034-129784056 TGCCATGTGGCCACTGCTGGAGG - Intergenic
997637172 5:135420854-135420876 TGGCAACTGGGCATACCTGGAGG - Intergenic
1000937308 5:167318155-167318177 TGGCTTCAGTTCACTCCTGTTGG + Intronic
1002840799 6:903726-903748 TGACTTCTGATCACCCCTGGTGG - Intergenic
1005037537 6:21570402-21570424 TGCCATGTGGCCACTGCTGGGGG + Intergenic
1011270955 6:85579555-85579577 TGACATGTGGCCACTTCTGGGGG - Intronic
1012940547 6:105410204-105410226 GCACATCTGGTCACACCTGGAGG + Intergenic
1012978566 6:105805996-105806018 TGGCAACTGGTGACTTCTAGGGG + Intergenic
1013134227 6:107264405-107264427 TGTCATGATGTCACTCCTGGAGG - Intronic
1016423923 6:143913798-143913820 TGGCTCCATGTCACTCCTGGTGG + Intronic
1019157887 6:170051230-170051252 AGGCCTCTGGTCCCGCCTGGGGG - Intergenic
1019273174 7:161967-161989 TGGCGTCGGGACACTCCTGCGGG - Intergenic
1019284569 7:217127-217149 CTGCATCTGCTCACCCCTGGGGG - Intronic
1021669649 7:23022581-23022603 TGGTTTCTGGTCAGTCCTGCTGG + Intergenic
1021884994 7:25129482-25129504 TGCCATGTGGCCACTGCTGGGGG + Intergenic
1024382433 7:48713202-48713224 GGGCATATGGTCTCTCCAGGTGG + Intergenic
1024684208 7:51727514-51727536 TGTCAGCTGCTCCCTCCTGGGGG + Intergenic
1025705564 7:63859264-63859286 TTGTATCTGGCCCCTCCTGGTGG - Intergenic
1025739335 7:64183192-64183214 AGGTATCTGGTAACTCGTGGAGG - Intronic
1028892517 7:96003738-96003760 TGGCCTCTGTCCACTCTTGGTGG - Intronic
1030605155 7:111632791-111632813 TGGCATCTGGGAACTCCTCGTGG - Intergenic
1031438860 7:121767489-121767511 TGGCCTCTTGTGAGTCCTGGAGG - Intergenic
1033403441 7:141049236-141049258 TGGCATTTGGTCATTGGTGGTGG + Intergenic
1036452493 8:8881039-8881061 AGGCATCGGGTTACTGCTGGTGG - Intronic
1039711767 8:40062159-40062181 TGGCACCTGATCACCCCTGCTGG + Intergenic
1039711780 8:40062203-40062225 TGGCACCTGATCACCCCTGCCGG + Intergenic
1039880931 8:41625261-41625283 TGGCACCTGGGCACTCTTGGAGG - Intergenic
1039904481 8:41776056-41776078 AGGCATCATGTTACTCCTGGAGG - Intronic
1040638544 8:49304098-49304120 AGGCCACTGTTCACTCCTGGAGG + Intergenic
1042337128 8:67640529-67640551 AGGCATCTCTACACTCCTGGGGG - Intronic
1042382055 8:68128434-68128456 TGTCATCTGGCCATTTCTGGTGG + Intronic
1049067084 8:140324934-140324956 TGGCATTTGGTCTGTCTTGGTGG - Intronic
1049552770 8:143268026-143268048 TCGCCTCTGCTCAGTCCTGGGGG + Intronic
1049608068 8:143538890-143538912 GGGCCTTTGGTCACTCCAGGGGG + Exonic
1052041033 9:23739353-23739375 TGGCATTTGCTCTATCCTGGTGG - Intronic
1052609953 9:30759143-30759165 TGGCCTCTCCTCGCTCCTGGCGG - Intergenic
1055623570 9:78150228-78150250 TGGCTTCTAGCCACTCCAGGAGG + Intergenic
1055709931 9:79049739-79049761 TTGGTTCTAGTCACTCCTGGTGG + Intergenic
1055854470 9:80669590-80669612 TGGCATCTGAACACTCCTCCTGG - Intergenic
1056043773 9:82695492-82695514 TGGCATCTGAACACTCCTCTTGG - Intergenic
1058456554 9:105143240-105143262 TGGCTTCTGCTTCCTCCTGGTGG - Intergenic
1060559458 9:124530689-124530711 TGGCTGATGGCCACTCCTGGGGG - Intronic
1060668778 9:125450234-125450256 TGGCAAGTGGTGACACCTGGGGG - Intronic
1061730296 9:132608973-132608995 GGAAATCTTGTCACTCCTGGAGG - Intronic
1187856134 X:23637404-23637426 TGGCATCTGTGCACTCCTCTTGG + Intergenic
1190740403 X:53284744-53284766 GGGCACCTGGTCACACATGGTGG + Intronic
1194254986 X:91624320-91624342 TGGCATGAGGTCACTGCTAGTGG + Intergenic
1197655871 X:129115384-129115406 TGGCATCTAGACACTGCTGGTGG - Intergenic
1197759417 X:130016904-130016926 TAGCCTCTGGTCCCTTCTGGGGG - Intronic
1200573771 Y:4863923-4863945 TGGCATGAGGTCACTGCTAGTGG + Intergenic