ID: 968557730

View in Genome Browser
Species Human (GRCh38)
Location 4:1256298-1256320
Sequence TTCCCATGCTGTTCTCGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968557723_968557730 12 Left 968557723 4:1256263-1256285 CCAGTGGGAAGTAATTGAATCAT 0: 136
1: 1997
2: 3928
3: 4467
4: 4658
Right 968557730 4:1256298-1256320 TTCCCATGCTGTTCTCGTGGTGG No data
968557722_968557730 13 Left 968557722 4:1256262-1256284 CCCAGTGGGAAGTAATTGAATCA 0: 120
1: 1750
2: 5152
3: 6970
4: 8649
Right 968557730 4:1256298-1256320 TTCCCATGCTGTTCTCGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968557730 Original CRISPR TTCCCATGCTGTTCTCGTGG TGG Intergenic
No off target data available for this crispr