ID: 968562465

View in Genome Browser
Species Human (GRCh38)
Location 4:1291459-1291481
Sequence GATCTCTGTTGGTTTAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 207}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968562461_968562465 21 Left 968562461 4:1291415-1291437 CCAAGATGTAGGTGGTTGGTTTT 0: 1
1: 0
2: 0
3: 8
4: 150
Right 968562465 4:1291459-1291481 GATCTCTGTTGGTTTAGAGATGG 0: 1
1: 0
2: 0
3: 29
4: 207
968562460_968562465 24 Left 968562460 4:1291412-1291434 CCTCCAAGATGTAGGTGGTTGGT 0: 1
1: 0
2: 0
3: 8
4: 85
Right 968562465 4:1291459-1291481 GATCTCTGTTGGTTTAGAGATGG 0: 1
1: 0
2: 0
3: 29
4: 207
968562458_968562465 25 Left 968562458 4:1291411-1291433 CCCTCCAAGATGTAGGTGGTTGG 0: 1
1: 0
2: 0
3: 24
4: 119
Right 968562465 4:1291459-1291481 GATCTCTGTTGGTTTAGAGATGG 0: 1
1: 0
2: 0
3: 29
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968562465 Original CRISPR GATCTCTGTTGGTTTAGAGA TGG Intronic
902595767 1:17508538-17508560 GACCTCTGTTTTTTTTGAGATGG + Intergenic
904200056 1:28813654-28813676 CATCTTTGTTGTTTTAAAGATGG - Intronic
904671267 1:32167580-32167602 GTTCTCTGTTGGATAAGAAAAGG - Intronic
905164325 1:36068546-36068568 GATCTCTGTTGGTTGGCAGAAGG - Exonic
907773996 1:57494829-57494851 AATCGCTCTTGGTTTAGAGTAGG + Intronic
908047200 1:60183952-60183974 GAAATCTGTTGGTTTTAAGAAGG - Intergenic
908135580 1:61128586-61128608 CATCTTTTTTGGTTTTGAGATGG - Intronic
909682883 1:78312384-78312406 GATCTTTGTTGGTTTAAAATCGG - Intronic
909700646 1:78518262-78518284 CTTCTCTGTTGGTTTAGCAAAGG + Intronic
911678615 1:100688738-100688760 GGTCGCTGTTGGTGTATAGAAGG + Intergenic
912150749 1:106855582-106855604 GATCTTTGTTGGTTTAAAGTCGG - Intergenic
912267795 1:108176035-108176057 CATCTCTGTTTCTTTAGGGATGG - Intronic
912282233 1:108327914-108327936 GATCTCTCTTGGTGCAGAGCTGG + Intergenic
913504119 1:119500019-119500041 GATCTTTGTTGGTTTAAAGTCGG - Intergenic
916331321 1:163620659-163620681 GATCACTGTTGGTATATAGCAGG + Intergenic
917162916 1:172078393-172078415 GGTCTTTGTTGGTTTAAAGTAGG + Intronic
919055617 1:192566180-192566202 AATATCAGTTGGTCTAGAGAAGG - Intergenic
919189188 1:194194234-194194256 GATTTCTGTTGGTTAAGGCAAGG + Intergenic
920260099 1:204683519-204683541 GAACTGTGTTGAATTAGAGAGGG + Intronic
923063137 1:230495387-230495409 GATTCCTGTTGGTTTAGTGATGG + Intergenic
924506568 1:244691091-244691113 AATTTTTGTTTGTTTAGAGATGG + Intronic
1069152442 10:64981144-64981166 GATGTTTCTTGGTTTACAGATGG - Intergenic
1069348728 10:67500701-67500723 TATCTTTGTTGGTTTAAAGTCGG + Intronic
1069545115 10:69322107-69322129 GTGCTCTGTTTGTTTAGAAAGGG + Intronic
1071378118 10:85031374-85031396 GATCTCTGTTGGTTTAATGTAGG + Intergenic
1072269926 10:93766507-93766529 GATCTCTTTTTTTTTTGAGACGG + Intronic
1073574092 10:104607137-104607159 GCTCTCAGGTAGTTTAGAGAGGG - Intergenic
1074175409 10:110995970-110995992 AATCTCTGAATGTTTAGAGATGG - Intronic
1079421470 11:20293754-20293776 GGTTTCTGTTTGTTTAGTGATGG - Intergenic
1079970951 11:27034172-27034194 GATCCTTGTTGGTTTAAAGTCGG - Intergenic
1081399841 11:42629968-42629990 GAGCTCTGATGGATTAAAGATGG + Intergenic
1081984652 11:47292836-47292858 GTTCTCTGTTGCTTCAGAGTTGG + Intronic
1083003449 11:59319236-59319258 GATCTTTGTTGGTTTAAAGTAGG + Intergenic
1085172073 11:74457853-74457875 GAGATCTGATGGTTTAGAAAGGG + Intronic
1085420542 11:76354670-76354692 GTACTCTGTTGGATTAGAAAAGG - Intronic
1085827899 11:79867061-79867083 GATCTTTTTTGGTTTAAAGTCGG - Intergenic
1086242299 11:84709925-84709947 GATGTCTTTAGGTATAGAGAAGG - Intronic
1087399663 11:97649629-97649651 TATCTTTGTTGGTTTAAAGTTGG + Intergenic
1088386518 11:109263992-109264014 GATCTCTATTTGTTTAAAGTTGG + Intergenic
1088386520 11:109264033-109264055 GATCTCTATTTGTTTAAAGTTGG + Intergenic
1089314504 11:117582396-117582418 GATCTTGGCTGGTTGAGAGAGGG + Intronic
1094315753 12:29136521-29136543 GATCACAGTTGGTTTATTGATGG - Intergenic
1094445367 12:30523931-30523953 GATCTTTGTTGGTTTAAAGTCGG + Intergenic
1094786203 12:33850359-33850381 GATCTTTGTTGGTTTAAAGTCGG - Intergenic
1094792705 12:33932782-33932804 GATCTTTGTTGGTTTAAAGTCGG - Intergenic
1095320144 12:40817422-40817444 GCTCTTTGTTGGTTTAAAGCCGG + Intronic
1097150071 12:56970658-56970680 GATCTTTGTTGGTTTAAAGTCGG - Intergenic
1100115900 12:91303730-91303752 GATCATTGTTGGTTTACAGTTGG - Intergenic
1100657831 12:96666584-96666606 GATATCTGATGGTTTATAAAGGG - Intronic
1101769267 12:107733458-107733480 GATCTTTGTAGGTTTAGACATGG - Exonic
1102252319 12:111395930-111395952 CATTTTTGTTTGTTTAGAGATGG + Intergenic
1104677482 12:130722620-130722642 GATCTTTGTTGGTTTGAAGTAGG - Intergenic
1108308336 13:49161374-49161396 GACCTTTGTTGGTTTAAAGTCGG + Intronic
1109582787 13:64364069-64364091 GATCTCTCTTGGTTTAACGTAGG + Intergenic
1110967649 13:81720808-81720830 GCTCTCTGTTAGTTCAGAAAAGG - Intergenic
1111834955 13:93376552-93376574 GAGCTCTGATGGTGTAGAGATGG - Intronic
1113014071 13:105807428-105807450 GTTCTCTGTTATTTTAAAGATGG - Intergenic
1113205784 13:107914113-107914135 TATATCTGTTTGTTTTGAGACGG - Intergenic
1113552549 13:111204499-111204521 GAGCTCTGTTTGTTTTGACATGG + Intronic
1114196037 14:20476989-20477011 GGTCTCTGGTGATTTAGATAAGG - Exonic
1114414163 14:22528517-22528539 GATCACTGTGGGTTTTCAGATGG + Intergenic
1114454952 14:22848307-22848329 GATCTCTGTTTGGCCAGAGACGG - Intronic
1114924437 14:27377160-27377182 GATCTCTGTTCTATTAGTGATGG - Intergenic
1115510508 14:34133241-34133263 GAACTGTGTTGCTTTAGATATGG + Intronic
1116409953 14:44609431-44609453 GATCTCTGGAGTTTTATAGAGGG + Intergenic
1116568903 14:46489443-46489465 GATCTCTGTTGATTTAGGGTTGG - Intergenic
1117154799 14:52927881-52927903 GGTCTCTGGTGGTTTAGATGAGG - Intronic
1119795786 14:77395796-77395818 CCTCTCTGTTTTTTTAGAGATGG - Intronic
1121143139 14:91558949-91558971 GATCTGTGTTGGTTTAAAGTTGG - Intergenic
1127527285 15:59805701-59805723 GATCTTTGTTGGTTTAAAGTCGG - Intergenic
1132275569 15:100560424-100560446 AATATCTGTTGATTTGGAGATGG + Intronic
1133194622 16:4160151-4160173 GGTGTTTGTTGGTTTTGAGATGG + Intergenic
1134023765 16:10939696-10939718 GGTCTCTGTAGGTGTAGACATGG - Intronic
1135814422 16:25619166-25619188 GAGTTTTGTTTGTTTAGAGATGG - Intergenic
1135820954 16:25685380-25685402 TCTCTCTCTTGTTTTAGAGATGG + Intergenic
1136252186 16:29012583-29012605 GATCTCTTTTTTTTTTGAGATGG + Intergenic
1137739683 16:50756396-50756418 GATCCCTTTTAGTTTTGAGAAGG + Intronic
1139282281 16:65781075-65781097 GATCAGTGATGGTTTATAGATGG + Intergenic
1140378661 16:74466405-74466427 GATATCTGAAGGTTTAGGGAAGG - Intronic
1140433360 16:74923797-74923819 TTTCTCTGTTGGTTTAGTGGTGG - Intronic
1142824273 17:2498187-2498209 GATCTCTTTTTTTTTTGAGATGG - Intronic
1143652781 17:8274328-8274350 GAACTGTTTTTGTTTAGAGATGG + Intergenic
1144036948 17:11375808-11375830 AATCTTTGTTGCTTTAGGGAGGG + Intronic
1144889252 17:18484604-18484626 GCTCTCTCCTGGTTTAGTGAGGG + Intronic
1145142956 17:20459692-20459714 GCTCTCTCCTGGTTTAGTGAGGG - Intronic
1147491259 17:40869075-40869097 GACCTCTGTTTGCTTATAGATGG + Intergenic
1149220806 17:54413689-54413711 GATCACTTTTGGTTTATTGATGG + Intergenic
1149543705 17:57487802-57487824 GATGTCTGTTGGCTGAGGGATGG - Intronic
1153538109 18:6124873-6124895 GATCTCTATTGCTTTAAAAATGG + Intronic
1155162871 18:23209703-23209725 AGTCTCTGTTGGTTGTGAGAAGG - Intronic
1156437915 18:37153454-37153476 GAACCCTGTTGGTTTAGAGTTGG + Intronic
1156664865 18:39392444-39392466 GATCTTTGCTGGTTTAAAGTCGG - Intergenic
1157059698 18:44273611-44273633 TATATTTGTTGGTTTTGAGATGG + Intergenic
1157125336 18:44951044-44951066 TGTCTGTGTTGGTGTAGAGAGGG - Exonic
1157172966 18:45424935-45424957 TATTTCTCTTGGTTTAGAGATGG + Intronic
1158346937 18:56525380-56525402 TATCACTATTGTTTTAGAGACGG + Intergenic
1158838136 18:61353671-61353693 GATCTCAGTGGGTTTGGAGTTGG - Intronic
1158964587 18:62611659-62611681 GGTCTCTGTGGCTTTAGAGTTGG - Intergenic
1159581579 18:70239084-70239106 GATCTTTGTTGGTTTAAAGTTGG - Intergenic
1162586734 19:11564208-11564230 ATTTTCTGTTGTTTTAGAGATGG + Intronic
1162962371 19:14135909-14135931 GATCTCCGTGGGTTAAGAAATGG + Intronic
1164780688 19:30889346-30889368 TATCTCTGTTGGTCTAGAGGGGG - Intergenic
1165692894 19:37877542-37877564 GTTCTTTGTTTGCTTAGAGATGG + Intergenic
925992762 2:9266896-9266918 TCTCTCTGATGGTTTAGAAATGG + Intronic
928864762 2:35904658-35904680 GATCTTTGTTGGTTTAAAGTCGG + Intergenic
929176148 2:38978579-38978601 GATTTCTTTTGCTTTAAAGATGG - Intergenic
930298421 2:49584378-49584400 AATCTCTTTTGGTTTATGGATGG + Intergenic
935436321 2:103038603-103038625 GATATCCATTGGTTTAGAGTTGG + Intergenic
936266627 2:111015935-111015957 GTTTTCTTTTGTTTTAGAGACGG + Intronic
936531197 2:113278098-113278120 GATCTCTGTGGAGTTAGAGGGGG - Intronic
937607450 2:123818573-123818595 GATATCTGATGGTTTATAAAGGG - Intergenic
938990296 2:136621229-136621251 GATCATTGTTGGTTTAAAGTCGG + Intergenic
940850307 2:158682032-158682054 GATCTTTGTTGGTGTAAATATGG + Intronic
944682256 2:202087804-202087826 GGTCTTTGTTTCTTTAGAGAAGG - Intronic
944740181 2:202604339-202604361 GTTCTTTGTTTGTTTTGAGATGG - Intergenic
945810937 2:214549395-214549417 ATTCTCTGGTGCTTTAGAGAGGG - Intronic
945989723 2:216385253-216385275 GAACTCTGTTAGTTCAGATAAGG + Intergenic
946544560 2:220723693-220723715 GGTCTCTGTTGGTGTATAGCAGG + Intergenic
947279576 2:228435039-228435061 GAACTCTGTTAGTTTATAAAAGG - Intergenic
948130137 2:235594577-235594599 GATTGCTGTTTGTTTTGAGAGGG + Intronic
1172462489 20:35130532-35130554 TATCTTTGTTTTTTTAGAGAGGG + Intronic
1173346895 20:42208510-42208532 GATCTTTGTTGGTTTAAAGTCGG - Intronic
1173623857 20:44457009-44457031 GCTCTCTTTTGGTTTGGAGTTGG - Intronic
1173985946 20:47261531-47261553 GATAACTGTTTTTTTAGAGATGG - Intronic
1179398750 21:41064760-41064782 CATCTCTGTGGGTTTGGAGTTGG - Intergenic
1182989059 22:34749398-34749420 GATCTTTGTTGGCTTAAAGTTGG + Intergenic
1184122460 22:42461046-42461068 GCTGTTTGTTGGTTTTGAGACGG - Intergenic
1184242920 22:43220911-43220933 GAGCTCTGTTAGGTTTGAGAAGG + Intronic
950590259 3:13931925-13931947 GATCTGTGGTGGCTTAGAAATGG + Intergenic
950768157 3:15289542-15289564 GTCCTCTGTTAGTTGAGAGACGG + Intronic
951069319 3:18307784-18307806 GATCTGTGTTGGCTTAGGGAAGG + Intronic
952407156 3:33014960-33014982 GATCCCTTTTTGTTTTGAGATGG - Intronic
952534245 3:34293690-34293712 GATCTCTGTGTATTTAGTGAAGG - Intergenic
954245416 3:49327532-49327554 GATCTCTTTTTTTTTTGAGATGG - Intronic
954520226 3:51218497-51218519 CATCTCTGCTGGCTTAGACATGG - Intronic
955798338 3:62660973-62660995 TATCATTCTTGGTTTAGAGATGG - Intronic
957037152 3:75304350-75304372 CATCTTTTTTGGTTTGGAGATGG + Intergenic
959651836 3:108757804-108757826 TATCTCTGTTGGCTGAGGGAGGG + Intergenic
960254961 3:115501920-115501942 GATCTCGGTGGCTTTATAGAAGG - Intergenic
960502240 3:118452343-118452365 TATCTTTGTTGGTTTAAAGTAGG + Intergenic
960696575 3:120402202-120402224 CATCTCTGTTAGTTGAAAGAGGG + Intronic
961080921 3:124027138-124027160 CATCATTGTTGGTTTGGAGATGG + Intergenic
962311227 3:134328384-134328406 AATCTCTTTTGCTTTAGGGAAGG + Intergenic
965284938 3:166806607-166806629 GATGGCTGTGGGTCTAGAGATGG - Intergenic
965624571 3:170673895-170673917 GATCACAGTTGGTTTATTGATGG - Intronic
965639717 3:170819328-170819350 GATCACAGTTGGTTTATTGATGG - Intronic
966544597 3:181131589-181131611 GATCTCTTTTGGCTTCCAGATGG + Intergenic
966569241 3:181422492-181422514 GAAATATGTTGGGTTAGAGAGGG + Intergenic
967008036 3:185403260-185403282 GATGTATGTTGGTTCAGAGTGGG - Intronic
967125964 3:186425008-186425030 GATCTTTGTTTGTTTTGAGATGG - Intergenic
967559781 3:190904589-190904611 GATATCTGATGGTTTATAAAGGG + Intergenic
968139030 3:196241354-196241376 TTTGTCTGTTTGTTTAGAGATGG + Intronic
968562465 4:1291459-1291481 GATCTCTGTTGGTTTAGAGATGG + Intronic
970083362 4:12316076-12316098 AATCTTTGTTTCTTTAGAGATGG + Intergenic
970726132 4:19047031-19047053 AATCTCTCTGGGGTTAGAGAAGG - Intergenic
972807694 4:42546665-42546687 GATGAGTGATGGTTTAGAGAAGG - Intronic
972977439 4:44653817-44653839 AATCTCTGCTGTTTTAGAAAAGG - Intronic
973665724 4:53156691-53156713 GCTCTTTGTTTGTTTTGAGACGG - Intronic
975023076 4:69514890-69514912 GATCTTTGTTGGTTTAAACTAGG - Intronic
979111455 4:116762395-116762417 GCTCTCCCTTGGCTTAGAGAAGG - Intergenic
979373505 4:119916867-119916889 GATATTTGTTGGTTTAAAGTTGG - Intergenic
981751873 4:148100144-148100166 GATCTCAGTTTATTTAAAGAAGG - Intronic
983547939 4:168982284-168982306 GATCATTGTTGGTTTAAAGTTGG - Intronic
984759625 4:183352460-183352482 GATCTCTCTTTTTTTTGAGATGG - Intergenic
987350849 5:17020505-17020527 GATCTCTTTTTTTTTTGAGACGG - Intergenic
987970765 5:24940813-24940835 GGTATCTTTTAGTTTAGAGATGG - Intergenic
988709723 5:33761427-33761449 CATCTCTGATGGCTTAGTGATGG + Intronic
989158153 5:38364500-38364522 GAGCTCTGTGGGGTGAGAGATGG + Intronic
990381177 5:55223200-55223222 GAGGTCTGTTGGTCTAGAAAGGG - Intronic
990945012 5:61239956-61239978 GAGCTCTGTTCCTTTGGAGAAGG - Intergenic
992601597 5:78406365-78406387 GCTGTTTTTTGGTTTAGAGATGG + Intronic
995340691 5:111055881-111055903 GATCTTTGTTGGTTAAAAGTCGG + Intergenic
996957988 5:129208627-129208649 GACCTTTGTTGGTTTAAAGTCGG + Intergenic
998049021 5:139015783-139015805 GATGTGTATTAGTTTAGAGATGG - Intronic
998972536 5:147608949-147608971 GATTTTTGTTGGTTTAAAGTCGG + Intronic
999126820 5:149252067-149252089 GGTCTCTGATGGTCAAGAGAAGG + Intronic
999540158 5:152562501-152562523 AATCACTGTTTGTTTTGAGATGG + Intergenic
1000548305 5:162628095-162628117 GACCTCTGTTGGTTTAAAGTTGG - Intergenic
1002015931 5:176322752-176322774 GATATCTGTTGCCATAGAGAAGG + Intronic
1002186577 5:177457499-177457521 GATCTCTGTGGCGTTAGAAAGGG + Exonic
1002206662 5:177567736-177567758 GATATCTCTTGGCTTAGAGTTGG + Intergenic
1002905141 6:1442320-1442342 GATCTCTGATGGTTTTATGAGGG - Intergenic
1003939740 6:11012397-11012419 GATCTGTGTTGCTTTAGAATGGG + Intronic
1005626699 6:27669115-27669137 GTTCTTTGTTTGTTTTGAGACGG - Intergenic
1007583282 6:42972463-42972485 GATTTCTATTGTTTTTGAGAGGG - Intronic
1009421021 6:63465182-63465204 GCTCTTTGTTTGTTTTGAGATGG + Intergenic
1011387444 6:86813391-86813413 GATCTTTGTTAGTTTAAAGTTGG + Intergenic
1011543900 6:88463992-88464014 GCTCCCTGTTGATTTTGAGAAGG + Intergenic
1015341525 6:132106267-132106289 TATCTCTGTAAGTTAAGAGATGG - Intergenic
1017658615 6:156652883-156652905 GATATGGGATGGTTTAGAGATGG - Intergenic
1019129173 6:169860780-169860802 GATATCTGATGGTTTAAAGGTGG + Intergenic
1020690699 7:11351395-11351417 GATCTTTGTTGGTTTAAAGTCGG + Intergenic
1023319472 7:38977455-38977477 TATCTCTGTTGTTTTATATAAGG - Intergenic
1023353118 7:39339917-39339939 GAGCTCTGCTGGGTTGGAGATGG - Exonic
1023511378 7:40957394-40957416 GATCTTTGTTGGTTTAAAGTTGG + Intergenic
1023776136 7:43609592-43609614 GATCTCTGTTGATTTTCTGATGG + Intronic
1024297751 7:47859481-47859503 TCTCTCTTTTTGTTTAGAGATGG + Intronic
1024553711 7:50584810-50584832 AATCTCTGATGGTTTGGGGAGGG + Intergenic
1029646335 7:101858610-101858632 GAGCTGTGGTGGTTTAGTGAGGG + Intronic
1030787171 7:113676141-113676163 GATCTCTGTAGTGTAAGAGATGG + Intergenic
1031379046 7:121062132-121062154 GTGCTTTGTTGGTTAAGAGAAGG + Intronic
1031556523 7:123183322-123183344 TATCTCAGTTTGTTAAGAGAAGG - Intronic
1032936236 7:136734952-136734974 GTTCTCTGTTTGTTGAGAGTTGG - Intergenic
1033721708 7:144066672-144066694 GGTCACTGTTGGTCTATAGAAGG - Intergenic
1034525058 7:151653835-151653857 GATTTTTGTTCGTTTTGAGATGG - Intronic
1035882461 8:3257318-3257340 GTTTTCTGTTTGTTTTGAGATGG - Intronic
1036139471 8:6193434-6193456 GATCTTTGTTGGTTTAAAGTCGG - Intergenic
1037037154 8:14181459-14181481 GTTCTCTGTTGATTTGGGGATGG - Intronic
1037359344 8:18056392-18056414 CATCTGTGTTGGTTTGGAGGAGG - Intergenic
1039733402 8:40304536-40304558 GATCTGTGTTGATGTTGAGAGGG - Intergenic
1040473419 8:47755737-47755759 GATCTCTGTTTGTTTATTGTTGG + Intergenic
1040519702 8:48165171-48165193 GATCTCTGTTTGTTTATTGTTGG + Intergenic
1041638124 8:60166589-60166611 GGTCGCTGTTGGTGTATAGAAGG - Intergenic
1042541333 8:69909886-69909908 GATCTTTGTTGGTCAAAAGAGGG - Intergenic
1043037151 8:75212413-75212435 CATTTCTGGTGTTTTAGAGATGG - Intergenic
1043468876 8:80542006-80542028 GAGCTCTATTGGTTTACAGCTGG + Intergenic
1046566307 8:115905568-115905590 GGTCTCTGTTGCTTGATAGATGG - Intergenic
1047978165 8:130152314-130152336 GTTTTCTGTTGGTTTAAAAAGGG + Intronic
1048266039 8:132987882-132987904 CATTTCTGTTGCTCTAGAGAAGG - Intronic
1050257798 9:3812701-3812723 GATCACACTTGGTTTATAGACGG - Intergenic
1052670297 9:31548457-31548479 GATCTCTGCAGCTTTAGATATGG - Intergenic
1053389104 9:37720662-37720684 GATCTCTTTTTTTTTTGAGATGG - Intronic
1059354922 9:113691314-113691336 AATTTCAGTTGGTTTAGGGATGG - Intergenic
1059713667 9:116893434-116893456 GATCTCTCCTGCTTTAGAGTGGG - Intronic
1186386884 X:9119232-9119254 GAGCTCTGTTGGGATAAAGATGG - Intronic
1186786289 X:12959129-12959151 GATCTCAGATGCTGTAGAGACGG - Intergenic
1187470184 X:19562770-19562792 GATGGCTGTTGGCTTGGAGAGGG - Intronic
1187731337 X:22258131-22258153 GTTTTGTTTTGGTTTAGAGACGG - Intergenic
1189310847 X:40016176-40016198 GACCTCTGTTGCTTTGGACAGGG + Intergenic
1190074127 X:47303168-47303190 GGTCTTTGTTTGTTTAGAGATGG - Intergenic
1190079108 X:47341501-47341523 GATCTTTTTTTTTTTAGAGATGG + Intergenic
1192914816 X:75640603-75640625 GATGTCTGTTTATTTAGACATGG + Intergenic
1193315841 X:80064320-80064342 GATCTTTGTTAGTTTAAAGTCGG + Intergenic
1196998130 X:121407011-121407033 TATCTCTATGGGTTTAGGGAAGG + Intergenic
1197011412 X:121569322-121569344 AATCATTGTTGGTTTAGAGATGG + Intergenic
1197477636 X:126943408-126943430 GATCTCTCTTGGTTTAATGTAGG - Intergenic
1201966019 Y:19736836-19736858 GCTCTGAGTTGGTTTACAGAAGG - Intronic