ID: 968563456

View in Genome Browser
Species Human (GRCh38)
Location 4:1296819-1296841
Sequence GTGTCACGGGAGCCGAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968563456 Original CRISPR GTGTCACGGGAGCCGAGTGA TGG (reversed) Intronic
900227854 1:1541080-1541102 GTGGCACAGGAGCCGAGGGCAGG + Intergenic
906307440 1:44728675-44728697 GTGTGTCTGGAGCAGAGTGAAGG - Intergenic
911400507 1:97368826-97368848 GTGTCAGAGGAGCCTAGTTAAGG + Intronic
920061109 1:203227594-203227616 GTGTCACAGGACCCCAGTGTGGG + Intronic
920136123 1:203770716-203770738 TTGGAATGGGAGCCGAGTGAAGG - Intronic
920648326 1:207819116-207819138 GTGTATCGGGAGCCGGGAGATGG - Intergenic
923712523 1:236398532-236398554 GTGTCAGGTGAGGCAAGTGAAGG - Intronic
1063424993 10:5943800-5943822 GTGTCACGGGAGGCAAGGGAAGG + Intronic
1067451559 10:46384968-46384990 GTGTCTGGGGAGGAGAGTGAGGG + Intronic
1067585680 10:47474788-47474810 GTGTCTGGGGAGGAGAGTGAGGG - Intronic
1069060250 10:63887352-63887374 GCGCCACGGGAGCCCAGCGAGGG - Intergenic
1069718817 10:70537496-70537518 GTGTCGCTGGAGCTAAGTGAGGG + Intronic
1070707588 10:78651921-78651943 ATGGCACATGAGCCGAGTGATGG + Intergenic
1077429822 11:2510853-2510875 GGGCCAGGGGAGCAGAGTGATGG - Intronic
1079978334 11:27121248-27121270 GTGTGACTGGAACAGAGTGAAGG + Intronic
1083750360 11:64757740-64757762 GGGTCAGGGGAGCCCAGAGAAGG - Intronic
1083941613 11:65899397-65899419 GAGTCACGGCGGCCGAGTCACGG - Intronic
1084322470 11:68381323-68381345 GTGTCACGGGAGCCCTCTGCAGG + Intronic
1087111036 11:94467450-94467472 GTGACACGGGAGCAGACTAAAGG + Intronic
1089413835 11:118270108-118270130 GTGTGGCTGGAGCAGAGTGAAGG + Intergenic
1093041898 12:14390341-14390363 GTGCCATGGGAGCCAAATGAAGG + Intronic
1097254647 12:57664558-57664580 GAGTCACGGGAGCCCAATGTAGG - Intergenic
1100892823 12:99145139-99145161 GTGTCATGGGAGGACAGTGAAGG + Intronic
1101835533 12:108292424-108292446 GTGTCCCGGAAGACGAGAGATGG + Exonic
1104440484 12:128789669-128789691 GTGTCTTGGAAGCCAAGTGAAGG - Intergenic
1104735155 12:131131977-131131999 GGGTCACGAGAGCCAAGCGAGGG - Intronic
1105439466 13:20403232-20403254 GTGTCAGGGGAGCCCACTGGTGG + Intergenic
1107632764 13:42359092-42359114 ATTTCACGGGAGCTGAGTGAGGG - Intergenic
1113443703 13:110349370-110349392 GTGGCACAGGATCCTAGTGAAGG + Intronic
1120821044 14:88912190-88912212 GTGTGCCTGGAGCAGAGTGATGG + Intergenic
1130274267 15:82468445-82468467 TTGTTCCGGGAGCCCAGTGATGG + Intergenic
1130466613 15:84195819-84195841 TTGTTCCGGGAGCCCAGTGATGG + Intergenic
1130497651 15:84477717-84477739 TTGTTCCGGGAGCCCAGTGATGG - Intergenic
1130588909 15:85200412-85200434 TTGTTCCGGGAGCCCAGTGATGG + Intergenic
1131101047 15:89690518-89690540 TAGGCACGGGAGCCGAGTTAGGG + Intronic
1132146841 15:99434156-99434178 GGGTCACGGCTGCCGAGTGCAGG - Intergenic
1133606875 16:7396096-7396118 GTGTCAGGGGAGGGGATTGAGGG + Intronic
1136532862 16:30881681-30881703 GTGTGACTGGAGCGGAGGGAGGG - Intronic
1137955253 16:52823114-52823136 ATGTCACTGGAGCCGAGAGAAGG - Intergenic
1138075792 16:54041376-54041398 GTGTCAAGGGAGGGGAGTGGTGG - Intronic
1141091485 16:81133320-81133342 GGGTCACGGGAGCCGGGAGCGGG + Intergenic
1141310292 16:82907312-82907334 GTCTTCCGGGAGCCTAGTGAGGG - Intronic
1141484809 16:84331686-84331708 GTGCCAAGAGAGCCCAGTGAGGG + Intergenic
1142736803 17:1906127-1906149 GTGTGAAGGGAGTCCAGTGAAGG + Intergenic
1146557638 17:33840273-33840295 GTGTTAGGGGAGCCCAGTGTGGG + Intronic
1147449813 17:40497146-40497168 GTGTCACGAGAGAGGAGGGAAGG + Intronic
1147617377 17:41837520-41837542 GTGTCTAGGGAGCCAAGTGTTGG + Intronic
1149595893 17:57864490-57864512 GGGTCACAGGAGCCAAGGGAGGG + Intronic
1151658521 17:75506898-75506920 GGGTTGGGGGAGCCGAGTGAGGG + Intronic
1152549019 17:81020017-81020039 GGGTCAGGGGAGGAGAGTGAAGG + Intergenic
1152698616 17:81808188-81808210 GTGGCACTGGGGCCAAGTGATGG + Intronic
1154216235 18:12418782-12418804 GTCTGAAGGGAGCCAAGTGAGGG - Intronic
1157252669 18:46109328-46109350 GTGTCAGGGGAGGGGACTGATGG - Intronic
1157687994 18:49658450-49658472 GTGTGACTGGAGCCCAATGAGGG - Intergenic
1161646214 19:5454983-5455005 GTGTGGCTGGAGCAGAGTGAGGG + Intergenic
1161729442 19:5950258-5950280 GAGACACGGGAGCCGCGGGAAGG - Intronic
1163704352 19:18803708-18803730 ATGTGACTGGAGCAGAGTGAGGG + Intergenic
1165940469 19:39412685-39412707 GTGTCACGGGGCTCGTGTGACGG - Exonic
1166668214 19:44694272-44694294 GTGTGACTGGAGCTGAGTGAGGG - Intergenic
1166721927 19:45001789-45001811 GTTTCGCGGGGGCAGAGTGAGGG + Intronic
1166998864 19:46733123-46733145 GGGGCAGTGGAGCCGAGTGAAGG - Exonic
926774952 2:16412814-16412836 GTGTGGCTGGAGCAGAGTGAGGG - Intergenic
929083359 2:38143788-38143810 GTGTCACAGGAGCCAAGAGAAGG - Intergenic
931906552 2:66849369-66849391 GGGTCACAGGAGCCAAGAGAAGG + Intergenic
933157308 2:78990607-78990629 GTGTCATGGGAGCTGTGTAAAGG - Intergenic
948092228 2:235303870-235303892 GTGTCAGAGGAGCCAAGGGACGG - Intergenic
949074250 2:242045123-242045145 GTGTCCCGTGAACTGAGTGATGG + Intergenic
1168796406 20:612625-612647 GTGTGGCTGGAGCAGAGTGAGGG - Intergenic
1169680271 20:8204201-8204223 GTGTCAAGGGAGCAGAGGGATGG + Intronic
1170843060 20:19939635-19939657 GTGGGACTGGAGCTGAGTGATGG - Intronic
1173790382 20:45824261-45824283 GGGGCCCGGGAGCCGAGGGAGGG - Intronic
1175428716 20:58888630-58888652 GTGTCACGGGAGCCGAGGAGCGG - Intronic
1177785605 21:25668129-25668151 GTGTCCCTGGAGCAGAGGGAGGG + Intronic
1178009905 21:28272801-28272823 GTGTCATGGAAGCCAAGGGAAGG - Intergenic
1180188730 21:46152864-46152886 ATGAGACGGGAGCAGAGTGAGGG + Intronic
1181164136 22:20974400-20974422 GTGTCACTGGAGCAGAGTGAGGG + Intronic
1182106262 22:27691912-27691934 GTGTAAATGGAGCAGAGTGAGGG - Intergenic
1183343039 22:37292574-37292596 GTGTGGCTGGAGCCAAGTGATGG + Intronic
1184788041 22:46681205-46681227 GTGTCACTGGAGCCGGGCCATGG + Intergenic
949896726 3:8772894-8772916 CTGTCACGGGGGCAGAGGGAGGG - Intronic
950112137 3:10426022-10426044 GTGTCACTGGAGCACAATGATGG - Intronic
950399688 3:12760403-12760425 GTGTTACTGGAGCAGAGTGAGGG - Intronic
955475414 3:59331094-59331116 GGGTCAGGGGAGGGGAGTGAGGG - Intergenic
958707671 3:97676306-97676328 GTGTCATGGGATCCAAGTGAAGG + Intronic
958782548 3:98560102-98560124 GTGTCATGGGAGCAGGGGGAGGG + Intronic
959630774 3:108505004-108505026 GTGTCACAGAAGCCAAGAGATGG - Intronic
961325577 3:126107364-126107386 GGGTCACGGCACCCGTGTGATGG + Intronic
967799305 3:193638232-193638254 GTGTGGCAGGAGCTGAGTGAGGG + Intronic
968480444 4:830792-830814 GTGTCACTGGAGGAGAGGGAGGG - Intergenic
968563456 4:1296819-1296841 GTGTCACGGGAGCCGAGTGATGG - Intronic
968928319 4:3561903-3561925 GTCTCAGGGGAGCAGAGGGATGG + Intergenic
969639537 4:8388691-8388713 GTGCCACAGGGGCCGAGTGAAGG + Intronic
974443639 4:61951318-61951340 GTGTCAGGGGAGCCGACTCCTGG + Intronic
977673638 4:99724166-99724188 GTGTCAAGGGAGCTGAGTTTGGG - Intergenic
978359192 4:107910176-107910198 GTGTTAGGGGAGCGGAGTCATGG + Intronic
978630151 4:110734675-110734697 GTGTCAGGGGAGGGAAGTGATGG + Intergenic
979496839 4:121393201-121393223 GTGTCAGTGGAGCCAAGTGTGGG - Intergenic
981307953 4:143266685-143266707 GTGTCATGGGAGGCAACTGATGG + Intergenic
983238278 4:165204979-165205001 GTGTCTTGGCAGCCTAGTGAAGG - Intronic
984106029 4:175547074-175547096 GTGTCACAGGAGAAGAGGGAAGG + Intergenic
986799745 5:11246783-11246805 GTGACACCGGAGCTGAGTGGAGG + Intronic
990738993 5:58893292-58893314 GTGTCACTGGTGCAGAGTGATGG - Intergenic
991456073 5:66806029-66806051 GTGTCACAGGAGCCAACTAAAGG + Intronic
998334313 5:141357156-141357178 GTGTGACGGTGGCCGAGAGAGGG - Exonic
1003426831 6:6003386-6003408 GTGTCTGGGGAGCCGAGTGGCGG - Intronic
1004901396 6:20197437-20197459 GTGTCACGTGGGCAGAGGGATGG - Intronic
1007467635 6:42065724-42065746 CTGTCATGGGAGCTGAATGAAGG + Intronic
1010125955 6:72432018-72432040 GTGTCAGAAGAGCTGAGTGAGGG + Intergenic
1011128982 6:84034717-84034739 GTGTCCAGGGAGACGAGAGAAGG + Intronic
1011569506 6:88719253-88719275 GTTTCACGGAAGCTAAGTGAAGG - Intronic
1011729769 6:90249193-90249215 TTGCCATGGGAGCAGAGTGAGGG + Intronic
1011772548 6:90691063-90691085 GTGTCATGGGAACCCAGAGAAGG - Intergenic
1018227664 6:161644745-161644767 ATGGCATGAGAGCCGAGTGAAGG + Intronic
1019446364 7:1073723-1073745 GTGTGACGGCAGCGGGGTGAGGG - Intronic
1019446447 7:1073971-1073993 GTGTGACGGCAGCGGGGTGAGGG - Intronic
1019446540 7:1074246-1074268 GTGTCACGGCAGCGGGGTGCGGG - Intronic
1020277210 7:6631982-6632004 AAGTCCCGAGAGCCGAGTGAAGG + Intergenic
1022139229 7:27478239-27478261 GTGTCACTGGAACACAGTGAGGG - Intergenic
1022321649 7:29293559-29293581 GTGTGTCTGGAGCTGAGTGAGGG - Intronic
1022539444 7:31122195-31122217 GTCTCAGGGGAGCCGAGGGATGG - Intergenic
1022738463 7:33098547-33098569 GTGTTCTGGGAGCCGAGTGGAGG - Intronic
1030496893 7:110311711-110311733 CTGTCTAGGGAGCCAAGTGAGGG - Intergenic
1031027547 7:116696543-116696565 GTGTCACAAAAGCCAAGTGAGGG - Intronic
1032382220 7:131497172-131497194 GGGTCACTGGGGCCGAGTGGTGG + Intergenic
1034214710 7:149396456-149396478 GTGTCAGGGGAGCAGTGAGAAGG + Intergenic
1035204821 7:157288431-157288453 GTCTCAGGGGAGCAGAGGGATGG + Intergenic
1035279947 7:157771500-157771522 ATGTCACGGGTGCAGAGTGCTGG + Intronic
1038029863 8:23628483-23628505 GTGTGACAGGAGCCAAGTAAGGG - Intergenic
1038040454 8:23719932-23719954 GTGTCCTGGAAGCCAAGTGAAGG + Intergenic
1041918213 8:63157290-63157312 GTCTCACAGGAGCAGAGGGATGG - Intergenic
1042403994 8:68382617-68382639 GTGTCACAGGGGCCAAGGGATGG - Intronic
1042926017 8:73969493-73969515 GTGTGACTGGAGCATAGTGAAGG - Intronic
1042936219 8:74061112-74061134 GTGGCACAGGAGCCTAGAGAAGG - Intergenic
1043472945 8:80579080-80579102 GTGTCACTGGGGCCGGGGGACGG + Intergenic
1049936610 9:505556-505578 GTTCCACGGGACCCGGGTGAAGG - Intronic
1053803202 9:41777045-41777067 GTCTCAGGGGAGCAGAGGGATGG + Intergenic
1054142059 9:61538079-61538101 GTCTCAGGGGAGCAGAGGGATGG - Intergenic
1054191494 9:61988355-61988377 GTCTCAGGGGAGCAGAGGGATGG + Intergenic
1054646875 9:67599357-67599379 GTCTCAGGGGAGCAGAGGGATGG - Intergenic
1058772033 9:108244367-108244389 CTGTCACGGGACCTGAGTTAAGG - Intergenic
1060239564 9:121891058-121891080 GTGTCATGGGAGCCTAGTGAAGG - Intronic
1062558862 9:137130184-137130206 GCGTCGCGGGGGCCGAGGGAAGG + Intergenic
1186442827 X:9600824-9600846 GTGTCATGGGAGCAGAGAGAAGG + Intronic
1186604290 X:11073608-11073630 GGGACACAGGAGCCAAGTGAAGG + Intergenic
1196789050 X:119447723-119447745 GTGTCCAGGAAGCCAAGTGAAGG - Intronic
1199746844 X:150777126-150777148 GTATCAGGGGAGCAGAGGGACGG + Intronic