ID: 968563902

View in Genome Browser
Species Human (GRCh38)
Location 4:1299308-1299330
Sequence CTGTGACAACAGAGGCATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 195}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968563902_968563916 28 Left 968563902 4:1299308-1299330 CCTTGATGCCTCTGTTGTCACAG 0: 1
1: 0
2: 0
3: 15
4: 195
Right 968563916 4:1299359-1299381 CCTGGCGTCAGGACATGCCCAGG 0: 1
1: 0
2: 0
3: 12
4: 169
968563902_968563909 17 Left 968563902 4:1299308-1299330 CCTTGATGCCTCTGTTGTCACAG 0: 1
1: 0
2: 0
3: 15
4: 195
Right 968563909 4:1299348-1299370 TGCCCCTCCACCCTGGCGTCAGG 0: 1
1: 0
2: 1
3: 22
4: 220
968563902_968563906 10 Left 968563902 4:1299308-1299330 CCTTGATGCCTCTGTTGTCACAG 0: 1
1: 0
2: 0
3: 15
4: 195
Right 968563906 4:1299341-1299363 GCCCGTCTGCCCCTCCACCCTGG 0: 1
1: 0
2: 0
3: 23
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968563902 Original CRISPR CTGTGACAACAGAGGCATCA AGG (reversed) Intronic
901851013 1:12015594-12015616 CTGTGTAATCAGAGGCATAAGGG - Intergenic
902885552 1:19402274-19402296 TTGTCTCAACAGAGGCAACAAGG + Intronic
903337987 1:22637598-22637620 GTGTCTCCACAGAGGCATCATGG + Exonic
905245927 1:36613264-36613286 CTGTGGCCACAGAGGCAGAAAGG - Intergenic
905565629 1:38962199-38962221 ATGTGACCACAGAGGCATTGAGG + Intergenic
906043303 1:42806282-42806304 CAGTGACTTCAGAGGCAGCAGGG + Intergenic
907425956 1:54379463-54379485 CTGAGACAACAGAACCCTCAGGG + Intronic
913261455 1:117001875-117001897 CTGTGACAAGAGAAACATAAAGG - Intronic
914377023 1:147080598-147080620 CTGTGCCAAGAGAAGCAGCAAGG - Intergenic
914474712 1:148013700-148013722 CTGTGCCAAGAGAAGCAGCAAGG + Intergenic
915527859 1:156487204-156487226 CTGGGACGAGAGAGGGATCAGGG + Intronic
916607690 1:166359168-166359190 CTCTCACCACAGAGCCATCATGG - Intergenic
918385657 1:184005037-184005059 CCCTGAAAACAGAGGCATGATGG + Intronic
918984658 1:191608579-191608601 CTGTGAGAGCACAGGCATAATGG + Intergenic
919926100 1:202192681-202192703 CTGGGACCTCAGAGGCATCCAGG - Intergenic
920233027 1:204482798-204482820 CTGGGACACCACAGGCATCTTGG - Intronic
923434223 1:233953557-233953579 CTGTGCCAACAGAGCTATGACGG - Intronic
923439971 1:234008064-234008086 CTGGGACAACAGAGCCTCCAAGG - Intronic
924472370 1:244353801-244353823 CTGAGAAAACAGAAGCAACAGGG + Intronic
1063195688 10:3740629-3740651 CTGAGAAAACAGAGGTATTAAGG - Intergenic
1063857180 10:10268220-10268242 CTGAGATAACAAATGCATCATGG - Intergenic
1065552381 10:26881861-26881883 CAGTGACAACATAGGCAGCATGG + Intergenic
1066000815 10:31102786-31102808 CTGTGAAAAAATAGGCAACAGGG + Intergenic
1066580879 10:36880660-36880682 CAGTGACAATATAGGCAACATGG + Intergenic
1066810695 10:39330244-39330266 CTTTGTCAACATAGGCATCATGG + Intergenic
1067094519 10:43290391-43290413 CTTTGAAATCATAGGCATCATGG + Intergenic
1067315051 10:45153279-45153301 CAGAGACAACAGGGGCATCCTGG - Intergenic
1069979917 10:72245266-72245288 CTGTGGCCACAGAGTCAGCAGGG - Intergenic
1070749474 10:78955441-78955463 CTGTGACATCAGAAGCATTTAGG + Intergenic
1073038292 10:100579673-100579695 CTGTGACAACACAGTCATTAAGG + Intergenic
1075082812 10:119395319-119395341 CAGTGACCACAGAGGCAGCCAGG - Intronic
1075122967 10:119677841-119677863 CTTTGAAAGCAGTGGCATCATGG + Intergenic
1076503023 10:130951807-130951829 CTGGGACCACTGAGGCACCAGGG - Intergenic
1080615064 11:33938557-33938579 ATGAGACAACTGAGGCATAAGGG + Intergenic
1081639663 11:44744120-44744142 GTGAGACAACAGAGGCCTCCTGG + Intronic
1083203276 11:61132557-61132579 CAGTGACAACAGGGGCAGCTGGG + Intronic
1084393132 11:68891592-68891614 CTGGGACACCAGACGCCTCATGG + Intronic
1084935032 11:72582340-72582362 CTGGGAAGACAGAGTCATCAAGG - Intronic
1085621637 11:78042125-78042147 CTGTGACACCAGAAGCAAGATGG - Intronic
1089297702 11:117480095-117480117 CTCTGGCATCAGAAGCATCACGG - Intronic
1090026367 11:123170824-123170846 CTGTGACCAAGGAGGCAGCAGGG - Intronic
1092927319 12:13283078-13283100 CTGTGAAGACTGAGGCAGCAGGG + Intergenic
1094819607 12:34214284-34214306 CTCTGAAAACTGAGGCCTCAAGG - Intergenic
1095070191 12:37833182-37833204 CTTTGTCACCATAGGCATCAAGG - Intergenic
1095084709 12:38048911-38048933 CTCTGAAAACTGAGGCCTCAAGG - Intergenic
1095095125 12:38143194-38143216 CTCTGAAAACTGAGGCCTCAAGG + Intergenic
1095197116 12:39332970-39332992 CTGTCGAAACAGATGCATCAAGG - Exonic
1097896549 12:64829298-64829320 CTCAGGCAACAGATGCATCAGGG + Intronic
1099658637 12:85527452-85527474 CTGTGACGAGAGAGGCAGCCTGG - Intergenic
1102651278 12:114444235-114444257 CTGTGACCAGAGAAGCATTAAGG + Intergenic
1102964926 12:117118695-117118717 CTGCGACACCAGAGGCTCCAGGG - Intergenic
1103620743 12:122185758-122185780 CTGTGACCTCAAAGACATCAGGG - Intronic
1104151489 12:126088199-126088221 TTGTGAAAACAGAGGATTCAGGG - Intergenic
1104700277 12:130897851-130897873 CTGTGACAACGGAGAAAGCATGG - Intergenic
1107906746 13:45068289-45068311 CTGAGACAAGAGAGGTTTCAGGG - Intergenic
1112259640 13:97866753-97866775 CTGAGACCACAGAGGCAGCTAGG + Intergenic
1113110222 13:106814658-106814680 CTGTGACCACAGAAGGATCTAGG + Intergenic
1116189390 14:41644642-41644664 CTGTGATAAAAAAGGAATCAAGG + Intronic
1118589329 14:67389686-67389708 CTGAGACAGCAGACTCATCAGGG + Intronic
1122415130 14:101545782-101545804 ATGTCACAGAAGAGGCATCAGGG + Intergenic
1126705832 15:51404051-51404073 CTGTGCTAGCAGAGGCAACAGGG - Intronic
1127440445 15:59001247-59001269 CTCTGAGAACAGAGGTATGAAGG + Intronic
1129231426 15:74199172-74199194 CTGTATGAAGAGAGGCATCAAGG + Intronic
1129533443 15:76289853-76289875 CTGTTACAACATAGCAATCATGG + Intronic
1131890230 15:96964631-96964653 CAGTGACAACAGAGTCCTCGTGG + Intergenic
1135284454 16:21181496-21181518 CTGTGATCACAGTGTCATCAGGG + Intergenic
1135327605 16:21536973-21536995 GTGTGACAGCAGTGGCCTCATGG - Intergenic
1136337957 16:29622993-29623015 GTGTGACAGCAGTGGCCTCATGG - Intergenic
1138337246 16:56263033-56263055 CTGTGAGAACCAAGACATCAGGG + Intronic
1139738112 16:69010553-69010575 CTGTGACAGCAGAGGCAAGGTGG - Intronic
1142040717 16:87892074-87892096 GTGTGACAGCAGTGGCCTCATGG - Intronic
1142862510 17:2771371-2771393 CAGTCACAACAGAGGCGTCCTGG + Intergenic
1144201630 17:12947365-12947387 CTCTGACCACAGGGGCATCAGGG + Intronic
1148773547 17:50080309-50080331 TGGTGACAACGGGGGCATCAGGG - Exonic
1148893259 17:50823227-50823249 CTGTGCCAAATGAGGCATCCTGG - Intergenic
1149702180 17:58664308-58664330 CTGTGATATCAGAGCCATGAGGG - Intronic
1150062576 17:62081694-62081716 ATTTGAAAACAGAGGCATTATGG + Intergenic
1151015946 17:70552873-70552895 TTCTGACGACAGAGGCATAATGG - Intergenic
1151329305 17:73397497-73397519 CTGTGACAGCAGAGTGATCCTGG - Intronic
1152376266 17:79920325-79920347 CTGGGACAATAGAGGCAGCAAGG + Intergenic
1152644925 17:81464385-81464407 CTGGGACGACAGAGGCATCTCGG + Exonic
1152905025 17:82965298-82965320 CTGGGACAACAGAGGGAGAAGGG - Intronic
1153906243 18:9663953-9663975 CTATGACAATAGATGCATTAAGG + Intergenic
1155401390 18:25443368-25443390 CTGAGACAAAATAGGCGTCAAGG - Intergenic
1156563702 18:38159367-38159389 CTGTGGCAGCAGAATCATCAGGG - Intergenic
1159794189 18:72822048-72822070 CTGTGACAACAGAGCTGTCCAGG - Intronic
1161196458 19:2989229-2989251 CTGTGGCAGAAGAGGCATCAAGG + Exonic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1166080466 19:40441163-40441185 CTGTGACCACTGGGGCCTCAGGG - Exonic
925258595 2:2510577-2510599 CTGTGACCAAAGAGCCGTCAGGG + Intergenic
926111670 2:10187869-10187891 CTTTGAGAACCGTGGCATCAGGG - Intronic
927440028 2:23108041-23108063 CATGGCCAACAGAGGCATCAAGG - Intergenic
929865739 2:45715902-45715924 CTTTGAGATGAGAGGCATCATGG - Intronic
930948342 2:57105292-57105314 CTGTGAGAGCAGAGGCCACAGGG + Intergenic
933168773 2:79101766-79101788 CTATGAGAACAGAGCCTTCATGG + Intergenic
933438860 2:82283808-82283830 CTGTGATAACAGACACAGCACGG + Intergenic
934967881 2:98738619-98738641 CGGTGTGAACAGAGGCATCATGG + Intergenic
939286377 2:140135904-140135926 CTGTGATAACAGAGGCCTCCTGG + Intergenic
942641043 2:178060657-178060679 CAGTAACAACAGACGCATAAGGG - Intronic
946254509 2:218432988-218433010 CTGTGGCAAGACAGGCATCCGGG + Intronic
946637149 2:221742136-221742158 CTGTGACAAAAGAAGCACAAAGG + Intergenic
947011912 2:225575267-225575289 CAGTGACAGCAGAGGCCTGAAGG - Intronic
947872096 2:233444890-233444912 CTCTGACAACAGAGTGACCAGGG - Intronic
1172610869 20:36251588-36251610 CTGTCAAAGCAGAGGCATCTCGG - Intronic
1173177029 20:40772294-40772316 CTGTGATAATTGGGGCATCATGG - Intergenic
1173593840 20:44246383-44246405 TTGTGACAGCAAAGGCATTATGG + Intergenic
1174005479 20:47407538-47407560 CTGGGTCAACACAGGCATCTTGG - Intergenic
1174051155 20:47768534-47768556 CTGTGTGAACAGAGGCCTCAGGG + Intronic
1175736951 20:61393695-61393717 CTGACACAACAGAGGCGTGAGGG - Intronic
1176905177 21:14491696-14491718 ATGTGACAAGGGAGGCTTCATGG - Intronic
1178461805 21:32809130-32809152 CTGGGAAAGGAGAGGCATCACGG + Intronic
1180220127 21:46353265-46353287 CTGTTACAGCAGAGGCTGCAGGG + Exonic
1180912147 22:19458281-19458303 CTGTGACAACACTGCCATAAGGG + Intronic
1182068470 22:27446553-27446575 CCATGACAAGAGAGGCAGCATGG + Intergenic
1182135341 22:27897129-27897151 CCGTTACAACTGAGGCATAATGG + Exonic
1185108696 22:48888724-48888746 CTGTGGAAACAAAGGCAGCAAGG + Intergenic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
951712038 3:25592898-25592920 CCGTGTGATCAGAGGCATCATGG + Intronic
951901529 3:27662402-27662424 CTGTCACCACAGTGGCCTCAAGG + Intergenic
954284224 3:49607342-49607364 CTGAGCCAACAGAGGGACCAGGG - Intronic
954650787 3:52161455-52161477 CTGTGGCCACAGAGGCTTCCAGG - Intergenic
956357961 3:68414685-68414707 CTTTGACAACAGTGCCATGAGGG + Intronic
956857533 3:73290252-73290274 CAATGACAAGAGAGGCAGCATGG + Intergenic
958908747 3:99969967-99969989 CTGTTACATCAGAGGCATTAGGG + Intronic
959204896 3:103294010-103294032 CCATAACAACAGATGCATCAAGG + Intergenic
959447456 3:106457982-106458004 ATGTGACCACAGAGCCATAATGG + Intergenic
959457164 3:106576881-106576903 CTGTGGGAAAAGAGGCATTAGGG - Intergenic
959586734 3:108032192-108032214 CTGTGACTGAAGAGGCATCCTGG + Intergenic
960255897 3:115511311-115511333 ATGTGACAACAGAGGCTGGAGGG + Intergenic
960684115 3:120280090-120280112 CTGTGACCAGAGAGGCAACTTGG - Intronic
961871396 3:129991105-129991127 CTGATAAAACAGAGGCACCATGG + Intergenic
964184197 3:153923209-153923231 CTGTTATATCAGAGGCAGCATGG + Intergenic
964564088 3:158030626-158030648 CTGAGGAAACAGAGGCTTCAAGG - Intergenic
967259069 3:187624059-187624081 CTCTGTCAATAGAGGCAACAAGG - Intergenic
967530068 3:190538792-190538814 CTATCACAAGAAAGGCATCATGG - Intronic
968038593 3:195569509-195569531 CTCTGCCAGCAGCGGCATCATGG + Intronic
968563902 4:1299308-1299330 CTGTGACAACAGAGGCATCAAGG - Intronic
970083462 4:12317171-12317193 CTATGAAAACAGAGACAGCATGG - Intergenic
970475572 4:16418824-16418846 CTCTGACTACAGAAACATCAAGG + Intergenic
975033667 4:69656365-69656387 TTGTGATGACTGAGGCATCATGG + Intergenic
976764444 4:88584565-88584587 CTGTGACAACTAAGCCCTCATGG - Intronic
979069830 4:116187961-116187983 CAGTGAAAACAAATGCATCATGG + Intergenic
980623979 4:135347864-135347886 CTGTGACAACCGAAACATAAAGG + Intergenic
981653326 4:147083654-147083676 TGTTGACAACAGAGGCCTCAAGG - Intergenic
988506770 5:31830588-31830610 CTGTGATGACAGAGGAATCTGGG - Intronic
989631735 5:43490705-43490727 ATGTGACAACAGTAACATCATGG - Exonic
990294434 5:54386253-54386275 GAGTGACAGCAGAGGCATCTGGG - Intergenic
991452788 5:66770611-66770633 CAGTGACAAGACAGGCATGAGGG + Intronic
994796169 5:104302508-104302530 CTGTGTGAACAGAGGAAGCATGG - Intergenic
999596696 5:153213094-153213116 TTGTAACAACAGAGGCCACATGG + Intergenic
999844084 5:155459302-155459324 CAGTTACAACAAAGGCCTCAGGG - Intergenic
1002772374 6:300984-301006 CTTTGGCAACAGAGGCAGCAGGG - Intronic
1004095081 6:12546076-12546098 ATATGACAACAAAGGCATGAAGG - Intergenic
1004674714 6:17830538-17830560 CTGCGACCACAGTGGCAACAGGG + Intronic
1005130819 6:22505678-22505700 CTCTGAATGCAGAGGCATCAAGG - Intergenic
1005582226 6:27246255-27246277 GAGTGACAACAGAAGGATCAGGG + Intergenic
1005684956 6:28245390-28245412 CTGAGACATCAGAGGATTCATGG - Exonic
1006084885 6:31588604-31588626 CAGAGACAAGAGAGGCACCAAGG + Exonic
1006852959 6:37112638-37112660 CTGTGAGGACAGAGCCTTCATGG + Intergenic
1007291840 6:40793486-40793508 ATGCCCCAACAGAGGCATCATGG + Intergenic
1009252464 6:61321983-61322005 CTTTTACAACATAGGCCTCAAGG - Intergenic
1010064459 6:71665188-71665210 GTGTGACAACAGAAACATCTGGG - Intergenic
1010419799 6:75660482-75660504 CTGGGACAATTGAAGCATCAAGG - Intronic
1011345538 6:86366040-86366062 CTGGGACAAGAGAGGGTTCAGGG - Intergenic
1013392757 6:109703362-109703384 CTGACACTACAGAGGTATCAGGG + Intronic
1014241731 6:119025661-119025683 GTGTGACCACAGTGGCATGATGG - Intronic
1015738873 6:136431816-136431838 CTGTTAGAAAAGAAGCATCAAGG - Intronic
1016008442 6:139113223-139113245 CAGTGACAGTAGAGGCCTCAAGG + Intergenic
1017723139 6:157258396-157258418 CTGTGACAAGAAAGGCACCTGGG - Intergenic
1018907847 6:168085602-168085624 CTGTGAGAACAAAGGGACCAAGG + Intergenic
1018931269 6:168241905-168241927 CTGTGACAACAGACCCAAGACGG - Intergenic
1020708771 7:11579124-11579146 CTGTAACAACAGATTCATCTTGG - Intronic
1023923098 7:44645259-44645281 CTGTGGCCACAGATGCATCCTGG + Intronic
1026027524 7:66759142-66759164 ATGTGACTACAGAGTCATAAGGG - Intronic
1026166124 7:67911325-67911347 CAGTGCCAGCAGAGGCACCAAGG - Intergenic
1029974987 7:104825348-104825370 CTGTGAAAAGAGAAGCAACATGG + Intronic
1031345240 7:120657453-120657475 CTGTTATAACAGAGGCCTAAGGG - Intronic
1032205727 7:129863528-129863550 CTCTGAGAACAGAGGAATTATGG + Intronic
1035816473 8:2546725-2546747 CCGTGAATACAGAGGCATCTCGG - Intergenic
1037063294 8:14543632-14543654 CTGTAAAAACTGAGGAATCACGG + Intronic
1037087764 8:14873962-14873984 CTATGACTACAGAGACTTCAAGG - Intronic
1038061378 8:23917598-23917620 CAGTGACAACAGAGGAAACAAGG - Intergenic
1038852881 8:31297260-31297282 CTGTGACAACAGCAGCACCCAGG + Intergenic
1039793224 8:40891727-40891749 CTGTGCTAACAAAGGCATCCTGG - Intronic
1040615922 8:49038369-49038391 CTATGGCAACAGTAGCATCAAGG + Intergenic
1040697753 8:50022749-50022771 CAGTGGGAACAGAGGCAACATGG - Intronic
1044110392 8:88265868-88265890 CACTGACAACTGAGGCATTAGGG + Intronic
1044571985 8:93730232-93730254 CTGCAAAAACAGAGGCAGCAAGG + Exonic
1046737499 8:117792724-117792746 CTGTGACACTAGAGGGACCACGG + Intergenic
1047826678 8:128583880-128583902 CAGTTGCAACAGAGGCCTCAAGG - Intergenic
1049298628 8:141856996-141857018 CTTTGGCCCCAGAGGCATCAAGG + Intergenic
1051110263 9:13627480-13627502 CTCTGACAACAAAGGCAGTATGG - Intergenic
1052216368 9:25971691-25971713 CTGAGAAAACAGAGGCAGAAGGG - Intergenic
1057076333 9:92140140-92140162 CTGGGACCTCAGAGGCATCCAGG - Intergenic
1058675000 9:107392800-107392822 GTGGGACAAGAGAGGCATCGAGG - Intergenic
1059030702 9:110692721-110692743 TTATGACAACAGAGACATCAAGG - Intronic
1187722804 X:22169639-22169661 CTGGAGGAACAGAGGCATCAGGG + Intronic
1188358110 X:29217408-29217430 CTGTTACAGCAGAAGAATCATGG + Intronic
1189276535 X:39790549-39790571 ATGTGACAAAAGAGGAAGCAAGG + Intergenic
1190083369 X:47374247-47374269 CTGTGACAACAGATGAGTGAGGG - Intronic
1190931950 X:54956282-54956304 CAGGGAGAACAGAGGTATCAAGG + Intronic
1194240848 X:91445413-91445435 GTGTGACAAGAGTGGCATGAGGG - Intergenic
1196686021 X:118511027-118511049 CTGTGCCATCAGACACATCATGG - Intronic
1198227332 X:134657511-134657533 CTGTTACTACAGAGGCAGCAGGG - Intronic
1198402272 X:136279535-136279557 GCGTCACAATAGAGGCATCATGG - Intergenic
1198452423 X:136780475-136780497 CTGTGACACCACTGGCAACAAGG - Intronic
1199977166 X:152900876-152900898 GTGAGAAAACAGAGGCCTCAAGG - Intergenic
1201766079 Y:17574802-17574824 CTCTGAAAACCGAGGCCTCAAGG - Intergenic
1201774830 Y:17651013-17651035 CTCTGAAAACTGAGGCCTCAAGG + Intergenic
1201826726 Y:18254976-18254998 CTCTGAAAACTGAGGCCTCAAGG - Intergenic
1201835473 Y:18331187-18331209 CTCTGAAAACCGAGGCCTCAAGG + Intergenic