ID: 968565120

View in Genome Browser
Species Human (GRCh38)
Location 4:1308120-1308142
Sequence CACAGGCTGTACCACGGTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968565120_968565129 28 Left 968565120 4:1308120-1308142 CCCGCACCGTGGTACAGCCTGTG 0: 1
1: 0
2: 0
3: 7
4: 123
Right 968565129 4:1308171-1308193 GTCACTGCACTGAATACTGCAGG 0: 1
1: 22
2: 159
3: 898
4: 1665

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968565120 Original CRISPR CACAGGCTGTACCACGGTGC GGG (reversed) Intronic