ID: 968568455

View in Genome Browser
Species Human (GRCh38)
Location 4:1327172-1327194
Sequence AACTATCCCGAATGTAGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 48}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968568455_968568460 -7 Left 968568455 4:1327172-1327194 CCCAGTCTACATTCGGGATAGTT 0: 1
1: 0
2: 0
3: 2
4: 48
Right 968568460 4:1327188-1327210 GATAGTTGGGTCCAGAGGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 139
968568455_968568470 27 Left 968568455 4:1327172-1327194 CCCAGTCTACATTCGGGATAGTT 0: 1
1: 0
2: 0
3: 2
4: 48
Right 968568470 4:1327222-1327244 AGGAAGCAGTGGCCTCAGGGCGG 0: 1
1: 0
2: 5
3: 47
4: 459
968568455_968568462 -3 Left 968568455 4:1327172-1327194 CCCAGTCTACATTCGGGATAGTT 0: 1
1: 0
2: 0
3: 2
4: 48
Right 968568462 4:1327192-1327214 GTTGGGTCCAGAGGCCCGGTGGG 0: 1
1: 0
2: 1
3: 7
4: 110
968568455_968568471 28 Left 968568455 4:1327172-1327194 CCCAGTCTACATTCGGGATAGTT 0: 1
1: 0
2: 0
3: 2
4: 48
Right 968568471 4:1327223-1327245 GGAAGCAGTGGCCTCAGGGCGGG 0: 1
1: 0
2: 4
3: 52
4: 463
968568455_968568461 -4 Left 968568455 4:1327172-1327194 CCCAGTCTACATTCGGGATAGTT 0: 1
1: 0
2: 0
3: 2
4: 48
Right 968568461 4:1327191-1327213 AGTTGGGTCCAGAGGCCCGGTGG 0: 1
1: 0
2: 0
3: 5
4: 154
968568455_968568467 16 Left 968568455 4:1327172-1327194 CCCAGTCTACATTCGGGATAGTT 0: 1
1: 0
2: 0
3: 2
4: 48
Right 968568467 4:1327211-1327233 TGGGAGTGTAGAGGAAGCAGTGG 0: 1
1: 0
2: 1
3: 54
4: 550
968568455_968568468 23 Left 968568455 4:1327172-1327194 CCCAGTCTACATTCGGGATAGTT 0: 1
1: 0
2: 0
3: 2
4: 48
Right 968568468 4:1327218-1327240 GTAGAGGAAGCAGTGGCCTCAGG 0: 1
1: 0
2: 2
3: 30
4: 310
968568455_968568469 24 Left 968568455 4:1327172-1327194 CCCAGTCTACATTCGGGATAGTT 0: 1
1: 0
2: 0
3: 2
4: 48
Right 968568469 4:1327219-1327241 TAGAGGAAGCAGTGGCCTCAGGG 0: 1
1: 0
2: 3
3: 26
4: 280
968568455_968568464 7 Left 968568455 4:1327172-1327194 CCCAGTCTACATTCGGGATAGTT 0: 1
1: 0
2: 0
3: 2
4: 48
Right 968568464 4:1327202-1327224 GAGGCCCGGTGGGAGTGTAGAGG 0: 1
1: 0
2: 0
3: 12
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968568455 Original CRISPR AACTATCCCGAATGTAGACT GGG (reversed) Intronic