ID: 968569267

View in Genome Browser
Species Human (GRCh38)
Location 4:1331100-1331122
Sequence TTGTCTCCAGAGATGGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 240}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968569260_968569267 25 Left 968569260 4:1331052-1331074 CCCGTTGGCCGTGTTCTGTGCAC 0: 1
1: 0
2: 0
3: 10
4: 85
Right 968569267 4:1331100-1331122 TTGTCTCCAGAGATGGAATGAGG 0: 1
1: 0
2: 1
3: 18
4: 240
968569261_968569267 24 Left 968569261 4:1331053-1331075 CCGTTGGCCGTGTTCTGTGCACG 0: 1
1: 0
2: 1
3: 5
4: 56
Right 968569267 4:1331100-1331122 TTGTCTCCAGAGATGGAATGAGG 0: 1
1: 0
2: 1
3: 18
4: 240
968569263_968569267 17 Left 968569263 4:1331060-1331082 CCGTGTTCTGTGCACGTCTTGGC 0: 1
1: 0
2: 1
3: 5
4: 182
Right 968569267 4:1331100-1331122 TTGTCTCCAGAGATGGAATGAGG 0: 1
1: 0
2: 1
3: 18
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968569267 Original CRISPR TTGTCTCCAGAGATGGAATG AGG Intronic
901809096 1:11756084-11756106 TTGATTTCAGAGCTGGAATGTGG + Intergenic
903054702 1:20627554-20627576 TTGTCTGCAGAGGTGGAAGGCGG - Intergenic
906223886 1:44105212-44105234 TTACCTCTAGAGATAGAATGGGG + Intergenic
907148332 1:52257769-52257791 TTGTCTCCCAGGCTGGAATGCGG + Intronic
907261046 1:53218913-53218935 TTTTCCCCAAAGATGAAATGTGG - Exonic
910231836 1:84996187-84996209 TTCTCCCCAGAAATGGGATGTGG - Intronic
911582894 1:99655462-99655484 TTGCATCCAGACAAGGAATGTGG - Intronic
915379764 1:155429834-155429856 TTGTCACCCAGGATGGAATGTGG + Intronic
916420835 1:164636214-164636236 AGGTCTACAGAGATGGAAGGGGG + Intronic
916926899 1:169531381-169531403 TTGTCTCCAGATTTGTAGTGTGG - Intronic
921781157 1:219166125-219166147 ATGTCTCCAGATATAAAATGGGG + Intergenic
922409486 1:225357456-225357478 TTGTCTGCAGTGATGGTATCGGG + Intronic
924702612 1:246469051-246469073 TTTGCTCTAGTGATGGAATGTGG - Intronic
1062790142 10:298456-298478 ATGCCTCCAGAGAGGGCATGTGG - Intronic
1063226589 10:4020627-4020649 TTTTCTCTTGAGATGGAAGGAGG - Intergenic
1063901095 10:10733163-10733185 TTGTCTACACAGGTAGAATGTGG - Intergenic
1064646382 10:17464350-17464372 TTTTTTCCACAGATGGAGTGGGG - Intergenic
1064750961 10:18528294-18528316 GTGTTTACAGAGATGGTATGTGG + Intronic
1065146943 10:22779220-22779242 TTGTCTCCAAAGAAAAAATGTGG - Intergenic
1065742213 10:28807348-28807370 TTGTCTCCAGGGGTGGGAGGTGG - Intergenic
1067575783 10:47407454-47407476 TTATCTTCAGAGAGGGAACGTGG - Intergenic
1067581267 10:47447538-47447560 TTATCTACAGAGATGGGAGGTGG - Intergenic
1070826528 10:79393552-79393574 TTGTGTGCAGAGATTGAGTGTGG - Intronic
1072522162 10:96238360-96238382 TTGTTTCCAGAACTGGAAAGAGG + Intronic
1074486038 10:113881379-113881401 GTGTCTGCAGAAATGGAAAGTGG + Intronic
1075039037 10:119093002-119093024 CTGTTCCCAGAGCTGGAATGCGG - Intergenic
1075103223 10:119520110-119520132 CTTCTTCCAGAGATGGAATGTGG + Intronic
1075701323 10:124470930-124470952 TTGTCTTCAGAGATGGGAGCCGG + Intronic
1076234322 10:128852022-128852044 TCCACTCCAGAAATGGAATGGGG + Intergenic
1076434081 10:130427622-130427644 TGGTCTCCAGAGAGGGGATGGGG + Intergenic
1076552554 10:131292566-131292588 TTGTTTCCAAACATGGAATACGG - Intronic
1077229621 11:1452834-1452856 TTGTCGCCAAAGAGGGACTGTGG - Intronic
1078176612 11:8976482-8976504 TTGTCTTCAGAGTTGTCATGTGG - Intergenic
1079607172 11:22384587-22384609 CTGTCTCCATAAATGGAAGGTGG + Intergenic
1080121436 11:28682357-28682379 GTGTCTCCAGAGCGGGGATGTGG + Intergenic
1080603714 11:33845963-33845985 TTGTCTCCTCAGGTGTAATGTGG - Intergenic
1080766118 11:35298737-35298759 TTCTCCCCAGAGATGGAGGGTGG - Intronic
1083868566 11:65472178-65472200 GTGGCTTCAGAGATGGAGTGGGG - Intergenic
1083996838 11:66277078-66277100 TGGGCTCCAGAGACGGAGTGGGG - Exonic
1084359772 11:68661771-68661793 TGGTCTCCACAGCTGGAACGGGG - Intergenic
1084642427 11:70433896-70433918 GTGTGTGCAGAGATGGAATCCGG - Intronic
1084912315 11:72400709-72400731 TTGTGTACAGAGATCTAATGGGG + Intronic
1086402035 11:86468902-86468924 CTGTTTCCAGAGAAGGAATCTGG + Intronic
1089557971 11:119325692-119325714 TTATCTCCACAGATGTTATGAGG - Intergenic
1089790690 11:120941390-120941412 TTTTCTCTAGAGCTGGGATGTGG - Intronic
1090261315 11:125322659-125322681 TTGGCTGCAGAGCTGGAAGGGGG + Intronic
1090889044 11:130906624-130906646 TTGTCTCCAGGAAGGCAATGTGG - Exonic
1090933581 11:131321581-131321603 CTGTCTTCTGAGAAGGAATGAGG + Intergenic
1092178438 12:6427172-6427194 TTTTCTCCAGAGTTGGAAGGTGG - Intergenic
1093410432 12:18858710-18858732 TTGTCACCAGAAATGGAGAGTGG + Intergenic
1095450050 12:42320916-42320938 GTGGCTCCAGAGATGGAAGCAGG - Intronic
1096075796 12:48803288-48803310 CTGTCACCAGAGCTGGAGTGCGG + Intergenic
1096191787 12:49624084-49624106 TTGTCTCCTGAGGTGGAGAGGGG + Intronic
1096780132 12:53986817-53986839 TTTTCTCCTGAAAGGGAATGTGG + Intronic
1096814414 12:54192762-54192784 AAGTCCCCACAGATGGAATGGGG - Intergenic
1097624644 12:61985097-61985119 CTGTCAACAGAAATGGAATGTGG - Intronic
1098016385 12:66109016-66109038 TTGTTTCCATTGATAGAATGGGG - Intergenic
1098443153 12:70538848-70538870 TTTTCTCCAAAAATGAAATGAGG - Intronic
1098816830 12:75176268-75176290 TTCTCTCCTGAGCTGAAATGGGG + Intronic
1099846430 12:88033643-88033665 TTGTCTCCAGGGCTGGAAGTAGG + Intronic
1101172652 12:102114915-102114937 GTGGTTCCAGAGATGGAACGTGG - Intronic
1101214306 12:102565281-102565303 TTGTCTCCCTAGATAGATTGTGG + Intergenic
1102426218 12:112846405-112846427 TTGTTTCCAGAAAGGGAAGGAGG - Intronic
1103235752 12:119371124-119371146 CTGTCTCAAGAAATGGAATCAGG - Intronic
1103320517 12:120090303-120090325 TGATCTCCAGACTTGGAATGGGG + Intronic
1103564446 12:121808425-121808447 TGGTCTCCAAAGCTGGAGTGAGG - Intronic
1105272690 13:18892963-18892985 TTGTCTCCAGGAAGGCAATGTGG - Intergenic
1106113503 13:26797561-26797583 TTGTCCCCTGAGATAGAAGGGGG - Intergenic
1106184543 13:27397577-27397599 TGGTTTCCAGACATCGAATGAGG - Intergenic
1107186889 13:37533181-37533203 TTTTCTTCAGAAATGGAATATGG + Intergenic
1108556268 13:51595874-51595896 ATGCCTCCAGAGAGGGAATCAGG - Intronic
1111274088 13:85924990-85925012 CTGTCTCCAAGGCTGGAATGTGG - Intergenic
1112200138 13:97266651-97266673 TAGTCTCCAGAAATAGAGTGGGG + Intronic
1113097252 13:106679174-106679196 TTGTCTCCAGATAATGAATAAGG - Intergenic
1115098759 14:29672524-29672546 TTGTCACCAGAGATTTAATAAGG - Intronic
1115260210 14:31444431-31444453 TGGTCTGCAGAAAAGGAATGGGG + Intronic
1115383270 14:32764969-32764991 CTGTCACCAGGGCTGGAATGCGG + Intronic
1115900656 14:38143799-38143821 TGGTTCCCAGAGATGCAATGAGG - Intergenic
1117345354 14:54826772-54826794 TTGTTTCCAGAAAGAGAATGTGG - Intergenic
1117593649 14:57304006-57304028 TTGTCGAGAGAGATGAAATGAGG - Intergenic
1118460853 14:65985769-65985791 TTGTCCCCACAGCTGGACTGTGG - Intronic
1119995617 14:79250406-79250428 TTGTCCTCAGAGAAGGAAAGAGG + Intronic
1120496532 14:85244167-85244189 TTGTCTCAGGAAATGGAATCTGG + Intergenic
1120608211 14:86605787-86605809 TTTTCTCCAGTGTTGGAGTGGGG - Intergenic
1120963143 14:90143242-90143264 CTGTCTCCAGAGCTGAAATGCGG + Intronic
1121031199 14:90660022-90660044 TTCTCTGTAAAGATGGAATGAGG + Intronic
1121255013 14:92524859-92524881 GAGGCCCCAGAGATGGAATGTGG + Intronic
1122384074 14:101332044-101332066 TTGTCTCCAAGGAAGGAAAGTGG - Intergenic
1124433835 15:29631745-29631767 GTGTCCACAGAGATGGAGTGGGG - Intergenic
1125959167 15:43814439-43814461 TTGTCTCCAGGCCTGGAAAGTGG + Intronic
1127581360 15:60341881-60341903 GGGTTTCCAGAGATGGAAAGAGG - Intergenic
1127832914 15:62766663-62766685 TTGTGGCCAGAGATGTAATTTGG + Intronic
1128090659 15:64916718-64916740 TGGGCTCCAGAGAGGGGATGTGG + Intronic
1129302048 15:74631079-74631101 TTGTCTCCAGCGATGGGAAGAGG - Exonic
1131360795 15:91788910-91788932 ATTTCTCCAAAGATGGAGTGAGG + Intergenic
1131830240 15:96349957-96349979 TGGTCTCCAGGGATTGAATTTGG + Intergenic
1132405496 15:101539809-101539831 GTGTCTGCAGAGGTGGAAGGGGG + Intergenic
1133958087 16:10464715-10464737 ATGTTTACAGAGATGGAAAGGGG + Intronic
1133979031 16:10619880-10619902 TTTTTTCCAGAAATGGAATAGGG - Intergenic
1136065438 16:27755256-27755278 TGGACTCCAGAGATGGCATGGGG - Intronic
1136279790 16:29201550-29201572 GTGGCTCCTGAGATGGAATCAGG - Intergenic
1138599429 16:58046102-58046124 CTTTCTCCAGAGAGGGAAGGAGG - Exonic
1138774605 16:59706401-59706423 ATGTCTCCAGAGAGGGGATCAGG - Intergenic
1139684629 16:68593401-68593423 TTGTCTCCAGAGAGGGCAGAAGG + Intergenic
1141149857 16:81556549-81556571 GTGTCTCCAGAGACAGAAGGTGG + Intronic
1141245072 16:82298404-82298426 GTGGCTGCAGAGATGGGATGCGG - Intergenic
1141270412 16:82535140-82535162 TTGTTTTCTGAGATGGAATTTGG + Intergenic
1141445913 16:84058346-84058368 TTTCCTCCAGTGATGGTATGGGG - Intronic
1142084182 16:88167660-88167682 GTGGCTCCTGAGATGGAATCAGG - Intergenic
1143555961 17:7660481-7660503 TTGTTTTCTGAGATGGAATCTGG - Intergenic
1143842823 17:9747049-9747071 CTGTCTCCCGGGCTGGAATGCGG + Intergenic
1146354125 17:32119817-32119839 TTGCCTCAAGAAATAGAATGTGG + Intergenic
1147267978 17:39246381-39246403 CTATCCCCAGAAATGGAATGAGG - Intergenic
1147631148 17:41932579-41932601 CTGTCTCCCAAGCTGGAATGTGG + Intronic
1148436975 17:47692943-47692965 TTGGCTCCTGAGGTGGGATGGGG - Intergenic
1150036360 17:61803383-61803405 TTATTTCCAGTGATAGAATGGGG - Intronic
1150180692 17:63117472-63117494 TTGTATCCAGAGAAGCACTGTGG - Intronic
1150722455 17:67625255-67625277 TTGTCTCCTGAGATGGGACCTGG - Intronic
1151354718 17:73551493-73551515 CTGACACCAGAGATGGAAGGAGG - Intronic
1154464470 18:14630544-14630566 TTGTCTCCAGGAAGGCAATGTGG - Intergenic
1155045862 18:22102402-22102424 TTGTCTCCTGAGATTGTGTGAGG - Intergenic
1156149413 18:34224477-34224499 TTGTTTCCAGAGCTGGAAATAGG + Intronic
1156674819 18:39514780-39514802 TTGTCTCAGGAGATGGAATGTGG + Intergenic
1156752405 18:40474930-40474952 TTTTCTCGAGAGATGGAGTTAGG - Intergenic
1157190671 18:45578734-45578756 TTATCTCCATTGTTGGAATGAGG - Intronic
1157570305 18:48707907-48707929 ATATCTGCAGAGATGGAAAGTGG - Intronic
1159767160 18:72504121-72504143 TTGCCACAAGAGATGGAATCAGG - Intergenic
1161517894 19:4706809-4706831 TTGTCTCAAAAAAGGGAATGGGG + Intronic
1161590590 19:5127552-5127574 CTGTCTCCAGACAGGGGATGGGG + Intronic
1161739445 19:6011640-6011662 TTGTCTGCAGACATGGACTCTGG - Intronic
1163636332 19:18438628-18438650 TTGTCCCCCGAGATGGATGGGGG - Intergenic
927238922 2:20902726-20902748 CTGTCTCCAGAGTTTGGATGAGG + Intergenic
930525513 2:52524754-52524776 TTGACTCCAGAGATGGCAACTGG + Intergenic
930900893 2:56506702-56506724 CTGCCTCCAGAAATGGAGTGTGG + Intergenic
931800436 2:65752886-65752908 TAGTTTTCAGAGAGGGAATGGGG + Intergenic
935322222 2:101900307-101900329 CTGTCTCCAGAGGAGGAATGAGG - Intergenic
935614690 2:105065043-105065065 CTGTCTCCACTGATAGAATGAGG + Intronic
935923841 2:108045241-108045263 TTTTCACAGGAGATGGAATGTGG - Intergenic
937044052 2:118841742-118841764 TTTTATCCAGAGATAGAAGGGGG - Intergenic
939318683 2:140586653-140586675 TTGGCACCAGAGATGAAATTGGG - Intronic
941125877 2:161582240-161582262 TAATCTCCAGTGTTGGAATGGGG - Intronic
944429819 2:199620973-199620995 TTGTCTCCTGAAATGAAAAGGGG + Intergenic
947558024 2:231115367-231115389 CTGTTTCCAGAGTTGGTATGTGG + Intronic
948243299 2:236456578-236456600 TTGGCTTAAAAGATGGAATGTGG + Intronic
1168844291 20:932922-932944 TTGTCACCCAAGCTGGAATGCGG - Intergenic
1169140164 20:3223275-3223297 TGGTCTCCAGGGATGAGATGAGG + Intronic
1169362253 20:4960994-4961016 CTGCCTCCAGAGATGGAAACTGG + Intronic
1172327292 20:34046243-34046265 TTATCTCCAAAGAAGCAATGTGG + Intronic
1173129229 20:40372161-40372183 TTACCTTCAGAGATGGAATTTGG - Intergenic
1174048345 20:47749662-47749684 TTGTGTTCACAGATGGAAAGTGG + Intronic
1175435696 20:58945991-58946013 GTGGATCCAGAGATGGAGTGGGG + Intergenic
1175714206 20:61244854-61244876 TGTTCTCCAGAGATGACATGGGG - Intergenic
1176810066 21:13527845-13527867 TTGTCTCCAGGAAGGCAATGTGG + Intergenic
1177968450 21:27758988-27759010 TTGACTCCAGAGATGGCAGCTGG + Intergenic
1178904290 21:36623755-36623777 GTGGCTCCAGAGATGGGATCTGG - Intergenic
1180911742 22:19455590-19455612 TTGTCTCCAGAACTGGGGTGAGG + Intronic
1181172521 22:21017771-21017793 TTGTCTCAAGAGATGGACATGGG + Intronic
1181176830 22:21042610-21042632 TTGTCTCAAGAGATGGACATGGG - Intergenic
1181487773 22:23242332-23242354 TTATCACCTGAGATGGAATCGGG - Intronic
1181880392 22:25974874-25974896 TGGCCTCCAGAGAGGGAATGCGG + Intronic
1182654096 22:31876077-31876099 TTGTCTCCAGAGCATGACTGAGG + Intronic
1184383150 22:44158998-44159020 TTGCCTGCTGAGATGGAATCAGG + Intronic
1184640557 22:45867886-45867908 CTGTTTCCAGAGCTGGAAGGAGG - Intergenic
950067297 3:10123259-10123281 CTGTTTTCACAGATGGAATGTGG + Intronic
951448306 3:22807756-22807778 CTATCTCCAGAGCTGGACTGTGG - Intergenic
951722183 3:25712060-25712082 GTGTCTACAGTGATGGAAAGGGG + Intergenic
952744186 3:36762498-36762520 TTGTTTCCAGAGATCCAATGTGG - Intergenic
954410265 3:50367551-50367573 TGGTCTCCACAGATGCAAGGAGG + Intronic
954437820 3:50505192-50505214 TTGTGTCCAGAGGTGGCAGGGGG - Intergenic
955115757 3:55999076-55999098 TTGTATGCAGAGATGGTATCGGG - Intronic
956135865 3:66098157-66098179 TTAACTCTAGAGATGGTATGAGG + Intergenic
956174446 3:66459707-66459729 TTGTCTGCAGGGCTGGAATTGGG + Intronic
956596842 3:70976541-70976563 CTATCTCCAGAGATGGAACCTGG - Intronic
958029665 3:88092910-88092932 TTGTCTACAGGGAAGGAAAGTGG + Intronic
958680215 3:97320489-97320511 TTTTCTTGAGAGAGGGAATGAGG + Intronic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
961445032 3:126976435-126976457 TTGTCTCCAGACCGGGAGTGGGG + Intergenic
962093397 3:132268953-132268975 TTGTCACCAAAGAGAGAATGTGG - Intronic
962533281 3:136303638-136303660 TTGTCACCCAAGCTGGAATGCGG + Intronic
962840500 3:139228128-139228150 CTGTCTCGAGACATGGAATCTGG + Intronic
966780087 3:183576698-183576720 ATCTCTTCAGAGATGCAATGAGG + Intergenic
968569267 4:1331100-1331122 TTGTCTCCAGAGATGGAATGAGG + Intronic
968757391 4:2423869-2423891 TGGTCTCCAGACATGGGGTGGGG + Intronic
968940112 4:3633334-3633356 TTCTCTCCAGACATGGAAGGAGG - Intergenic
969446349 4:7246885-7246907 GTGCCTCCAGAGATGGCAGGAGG - Intronic
971098604 4:23436533-23436555 TTCTCTCTAGTCATGGAATGTGG - Intergenic
971310562 4:25522436-25522458 ATCTCTCCAGAAACGGAATGGGG + Intergenic
976788019 4:88844768-88844790 GTGTCTACAGAGATGGTAAGCGG + Intronic
977404713 4:96581668-96581690 TTCTCTTTAGAGATGGAATAAGG + Intergenic
977866530 4:102034976-102034998 TTGGCACCAGAGATACAATGGGG - Intronic
978348150 4:107793482-107793504 TTTTCTCCTGACATGCAATGTGG - Intergenic
978928540 4:114281718-114281740 TTATCACCATATATGGAATGTGG - Intergenic
979343660 4:119559147-119559169 TTTCCTACAGAGAGGGAATGTGG + Intronic
980394882 4:132199009-132199031 TGGTCTTCAGAGATCAAATGGGG - Intergenic
981305376 4:143241524-143241546 CTGTATCCAGGGATAGAATGGGG + Intergenic
981603073 4:146513102-146513124 TTGTCTCCAGAGAAGAAAACTGG + Intronic
982029703 4:151287841-151287863 TTGTCTCCCAGGCTGGAATGTGG - Intronic
985510931 5:313498-313520 TTGTCACCCCAGCTGGAATGTGG + Intronic
985569675 5:638211-638233 TTGTCTCCAAAGCTGGAATCGGG + Intronic
986652984 5:9982884-9982906 TTTTCTCCAGACATGGGGTGAGG - Intergenic
987627621 5:20422988-20423010 TTCTCTCCAGAGAGGGGAGGAGG - Intronic
987834150 5:23140112-23140134 TTTTATCCAGATGTGGAATGTGG + Intergenic
992326515 5:75665428-75665450 TTGTTTCAGGAGATGGAATGAGG + Intronic
996475992 5:123921279-123921301 TTGTAACAGGAGATGGAATGTGG + Intergenic
997081405 5:130743859-130743881 TTTTCTGCAGAAATGGAATGAGG - Intergenic
998099370 5:139419368-139419390 CTGTCTCCAGAGAGGGAAATAGG + Intronic
1003238534 6:4320452-4320474 TTGTATCCTGAGAGGGAAAGTGG + Intergenic
1004161289 6:13215472-13215494 CTGTCTCCAGATAGAGAATGAGG + Intronic
1005571025 6:27145862-27145884 TGGGCTGCAGAGATGGAATCAGG + Intergenic
1006905643 6:37531655-37531677 TTGTCTTCAGAGAGGGAAGCTGG + Intergenic
1006936251 6:37720572-37720594 CTGTCTGCAAAGATGGGATGGGG + Intergenic
1007062357 6:38953269-38953291 TTATGTACAGAGCTGGAATGGGG + Intronic
1007172921 6:39877238-39877260 TTGGCACAAGAGATGGCATGAGG - Intronic
1007431269 6:41778926-41778948 GTTTCTCCAGAGCAGGAATGTGG - Intronic
1008929043 6:56918161-56918183 TTGTCACCCAAGCTGGAATGTGG + Intronic
1009202120 6:60758793-60758815 TTGTCTCCGGAGAGCGGATGGGG - Intergenic
1012371708 6:98515122-98515144 TTTTCTCAAGAAATGGCATGTGG - Intergenic
1012960482 6:105616661-105616683 CTGTCCCCACAGATGGAATGAGG - Intergenic
1014546046 6:122736847-122736869 TTGTTTCCAAAACTGGAATGAGG + Intergenic
1016019290 6:139218895-139218917 ATATCTCCAGGGATGGAATTTGG - Intergenic
1016156290 6:140812940-140812962 TTTTCTCCAATGATGGAATTTGG - Intergenic
1018619976 6:165720811-165720833 CAGTCTCCAGAAATGGAAGGTGG + Intronic
1021580296 7:22145135-22145157 TCTGCTCCAGAGATGCAATGAGG - Exonic
1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG + Intergenic
1030653907 7:112145212-112145234 TTGCCTCAAGAACTGGAATGAGG + Intronic
1031885288 7:127240086-127240108 GTGTCTCAAGAGATGGCCTGGGG + Intronic
1032261262 7:130338847-130338869 GGGTCTCCAGAGATCGAATGAGG - Intergenic
1032327173 7:130940605-130940627 CTCTCTCCAGAGATGTGATGTGG - Intergenic
1034930381 7:155156959-155156981 TGGTCTCTGCAGATGGAATGTGG - Intergenic
1035963027 8:4158245-4158267 ATGTCTGCAGAGCTGGCATGGGG - Intronic
1036943602 8:13073713-13073735 TTGTTTTCAGAGATGGGATCTGG - Intergenic
1038136989 8:24796969-24796991 ATGTTTGCAGAGATGGAGTGTGG - Intergenic
1039453340 8:37693104-37693126 TTGTCACCTGGGAGGGAATGTGG - Intergenic
1041883377 8:62778985-62779007 GTGTGTCCAGAGATGTCATGTGG + Intronic
1043375759 8:79647576-79647598 TAGTGTCAACAGATGGAATGGGG - Intronic
1047172672 8:122509228-122509250 TTGACTCCAGGGAAGGAAGGAGG - Intergenic
1047194643 8:122710553-122710575 TTGGCTCCAGAGAGGGAAACTGG - Intergenic
1048474788 8:134733445-134733467 TTGAGGCCAGAGATGGAATGGGG + Intergenic
1049250149 8:141583887-141583909 CTGCTTCCAGAGATGGAAAGTGG + Intergenic
1049491392 8:142905022-142905044 GTGTCAGCAGAGTTGGAATGGGG - Intronic
1050169021 9:2796088-2796110 TGGTGTCCAGAGATGAAATTTGG - Intronic
1054450644 9:65401955-65401977 TCCTCTCCAGACATGGAAGGAGG + Intergenic
1057307950 9:93923271-93923293 GTTTCTCCAGTGATGAAATGTGG - Intergenic
1057905398 9:98978847-98978869 TTGTCTCCAGGGAAGGAAGCTGG - Intronic
1058949774 9:109892631-109892653 TTATATCCAGAGATGGTATAAGG + Intronic
1059672164 9:116501972-116501994 TTGCCTCCAGGGATGGAGTGGGG - Intronic
1061229006 9:129301367-129301389 TTGTCGACAGAGGTGGAGTGGGG + Intergenic
1061579141 9:131526215-131526237 CTGTCTTCTGTGATGGAATGGGG - Intronic
1062505254 9:136870838-136870860 CTGTCGCCTGGGATGGAATGCGG + Intronic
1188309012 X:28594819-28594841 GTGTCTCCAGGGATCAAATGAGG - Intronic
1188514962 X:30975402-30975424 CTATCTCCAGAGAGGGAAGGAGG + Intergenic
1191135972 X:57066100-57066122 TTGGGTCCAGAGATGGAAAAGGG - Intergenic
1193324410 X:80162594-80162616 ATTTCTCCACAGATGGAGTGGGG - Intergenic
1196665136 X:118308072-118308094 GGGACTCCAGAGAAGGAATGAGG + Intergenic
1197524377 X:127544585-127544607 TTGTTTCCAGAGATGCTATCCGG + Intergenic
1197633731 X:128891174-128891196 TTGTCACCAGAAATGGGATTGGG + Intergenic
1198674280 X:139115526-139115548 TGTTTTCCAGAGTTGGAATGGGG - Intronic
1199482026 X:148308266-148308288 AAGTCTGCAGAGATGGAACGGGG + Intergenic
1200827542 Y:7659764-7659786 GTGTGTCCAGAGAGGGAATGTGG + Intergenic
1200958005 Y:8970816-8970838 GTGTATCCAGCGAGGGAATGTGG - Intergenic