ID: 968569495

View in Genome Browser
Species Human (GRCh38)
Location 4:1331984-1332006
Sequence GGCTGGACTCCCTGCAGATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 193}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968569495_968569499 -10 Left 968569495 4:1331984-1332006 CCGGATCTGCAGGGAGTCCAGCC 0: 1
1: 0
2: 0
3: 16
4: 193
Right 968569499 4:1331997-1332019 GAGTCCAGCCTGTGGGCTGAGGG 0: 1
1: 0
2: 0
3: 22
4: 321
968569495_968569505 17 Left 968569495 4:1331984-1332006 CCGGATCTGCAGGGAGTCCAGCC 0: 1
1: 0
2: 0
3: 16
4: 193
Right 968569505 4:1332024-1332046 TGTTCTTCGGAAGGTTGTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 95
968569495_968569500 -7 Left 968569495 4:1331984-1332006 CCGGATCTGCAGGGAGTCCAGCC 0: 1
1: 0
2: 0
3: 16
4: 193
Right 968569500 4:1332000-1332022 TCCAGCCTGTGGGCTGAGGGAGG 0: 1
1: 1
2: 2
3: 44
4: 508
968569495_968569503 4 Left 968569495 4:1331984-1332006 CCGGATCTGCAGGGAGTCCAGCC 0: 1
1: 0
2: 0
3: 16
4: 193
Right 968569503 4:1332011-1332033 GGCTGAGGGAGGCTGTTCTTCGG 0: 1
1: 0
2: 2
3: 26
4: 359
968569495_968569504 8 Left 968569495 4:1331984-1332006 CCGGATCTGCAGGGAGTCCAGCC 0: 1
1: 0
2: 0
3: 16
4: 193
Right 968569504 4:1332015-1332037 GAGGGAGGCTGTTCTTCGGAAGG 0: 1
1: 0
2: 1
3: 12
4: 127
968569495_968569506 18 Left 968569495 4:1331984-1332006 CCGGATCTGCAGGGAGTCCAGCC 0: 1
1: 0
2: 0
3: 16
4: 193
Right 968569506 4:1332025-1332047 GTTCTTCGGAAGGTTGTGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968569495 Original CRISPR GGCTGGACTCCCTGCAGATC CGG (reversed) Intronic
900987617 1:6082325-6082347 GGCAGGAATCCCTGTAGCTCCGG - Intronic
901163744 1:7199617-7199639 GGCTGGGTTCCCTGGAGAACAGG - Intronic
901206860 1:7502541-7502563 GGAAGGACTCCCTCCACATCTGG + Intronic
901223258 1:7596125-7596147 GGCTTGGCTGCCTGCAGATGAGG + Intronic
902548622 1:17206143-17206165 GGCTGAACCCCTTGCAGATAGGG + Intronic
903010052 1:20323425-20323447 GGCTGGACTGACTGGAGGTCGGG - Exonic
904422501 1:30403245-30403267 GGCTGGAGGCTCTGCAGATAGGG + Intergenic
904601533 1:31675257-31675279 GCCTGGGCTCACTGCAGAACTGG - Exonic
905788143 1:40774326-40774348 GGCTGGCTTCCTTGCAGCTCAGG + Intergenic
906399789 1:45496467-45496489 TCCTGGCCTCCCTGCAGAACAGG + Exonic
907329923 1:53664059-53664081 GGCCAGACTCCCTGCAGAGTGGG - Intronic
910051369 1:82978024-82978046 GGCTGCACTCCCAGGAGGTCAGG - Intergenic
910449048 1:87328703-87328725 GGCTGAGCTCCCTGCACCTCCGG - Exonic
911666417 1:100557795-100557817 GGCTGCACTGCCTGCAGTTGGGG + Intergenic
912722747 1:112033874-112033896 GGCTGGACACCCAGGAGAGCTGG + Intergenic
913107128 1:115624952-115624974 GGGTGGACTGCTTGCAGACCAGG + Intergenic
915459889 1:156063694-156063716 GCCTGCACTCCCTGCAGCTTGGG + Intronic
915552775 1:156644818-156644840 GGCAGGACTTCCTAGAGATCAGG - Intronic
917724159 1:177813568-177813590 GTCTGGAGTCCCTGCAGACCTGG - Intergenic
917969381 1:180197247-180197269 GGCTGCCCTCCCTGCACAGCAGG - Exonic
919030734 1:192238617-192238639 GGCAGGACTTCCAGCAGATGGGG - Intergenic
919671487 1:200342261-200342283 GCCTGTAATCCCTGCAGTTCGGG + Intergenic
919838945 1:201595396-201595418 GGCTGGAGCCTCTGAAGATCTGG - Intergenic
920126535 1:203698161-203698183 GTCTGGGAACCCTGCAGATCTGG + Exonic
922567215 1:226608658-226608680 GGGTGGGCTCCCAGCAGGTCAGG - Exonic
1062961535 10:1576452-1576474 TGCTGGACTTCCTGCAAATACGG + Intronic
1063372886 10:5533235-5533257 GCCTGGCTTCCCTGCAGACCTGG - Intergenic
1063884940 10:10567801-10567823 GGCAGGACTCCCAGCAGCTGGGG + Intergenic
1065051088 10:21792632-21792654 GCCTGGAATCCCTGCTGCTCTGG + Intronic
1067275279 10:44828371-44828393 CGCTGGAGGCCCTGAAGATCAGG - Intergenic
1069405500 10:68094212-68094234 GGCTGCATTCCCAGCAGATTAGG - Intergenic
1070406775 10:76104488-76104510 GGCTGCCCTCCCTGCAGCTCTGG + Intronic
1070440300 10:76436440-76436462 GGCTGGGCCACCTGCAGGTCAGG + Intronic
1073448132 10:103593031-103593053 AGCTGAACTCCCTCCAGATGTGG - Intergenic
1074434443 10:113421807-113421829 GCCTGGGCTCCTTTCAGATCTGG + Intergenic
1075725355 10:124608109-124608131 GCCTGGAGTCCCAGCAGACCTGG - Intronic
1077556443 11:3228289-3228311 GGCTGGGCTCCCCGAAGAACTGG + Exonic
1077708903 11:4515841-4515863 GCCTGGAATCCCTGCACATCTGG - Intergenic
1077711840 11:4545252-4545274 GGCTGGAGTCCCTACACGTCTGG + Exonic
1078103207 11:8342125-8342147 GGCTGGACACCTTGCAGGTGGGG + Intergenic
1079967341 11:26994885-26994907 GGCGGGAGTCCCACCAGATCGGG + Exonic
1081530179 11:43953134-43953156 GGCTGCATTCCCAGGAGATCAGG + Intergenic
1081604227 11:44517363-44517385 GGCTGGGCTCCAGGGAGATCAGG + Intergenic
1082004965 11:47414408-47414430 GGCTCCCCTCCCTGCAGATCGGG + Exonic
1084118275 11:67054467-67054489 TGCTGGGCTCCCCACAGATCTGG + Intergenic
1088820633 11:113453742-113453764 GGCTGGACTCCCTAAAGACAGGG + Intronic
1092158645 12:6302487-6302509 GCCTGTACTCCCAGCAGCTCGGG + Intergenic
1093531843 12:20174907-20174929 GGCTGCACCGCCTGCAGTTCTGG + Intergenic
1102178424 12:110893397-110893419 GGCTGGACTCCCTGAAAAGGGGG - Intronic
1102197204 12:111034088-111034110 GGCTGGACTCCCCCCAGCCCCGG - Exonic
1102593986 12:113978457-113978479 GCCTGGTCTCCATGCAGATGTGG - Intergenic
1104847280 12:131852824-131852846 GGCTGGACTCCATGAGGATGTGG - Intergenic
1107708691 13:43131901-43131923 GGCTGCATTCCCAGGAGATCAGG - Intergenic
1107826057 13:44330149-44330171 CCCTGGTTTCCCTGCAGATCGGG + Intergenic
1108083601 13:46762141-46762163 GGCTGGAGAACCTGCAGTTCAGG - Intergenic
1108268845 13:48738778-48738800 AGCTGGACTCCATCCACATCAGG - Intergenic
1109370284 13:61413799-61413821 GTCCGGCCTCCCTGCAGACCTGG + Exonic
1109766747 13:66910184-66910206 GGCTGGACCCTCTGCAAACCTGG - Intronic
1113506541 13:110820923-110820945 GGCTAGACCCTCTGCAAATCTGG + Intergenic
1113777554 13:112956756-112956778 GCCTGGATTCCCAGCAGACCTGG - Intronic
1114626391 14:24132756-24132778 GCCTGGGCTCCCTGGAGACCAGG - Exonic
1118333915 14:64835575-64835597 TGCTGCTCTCCCTGCAGACCTGG - Intronic
1119187069 14:72650589-72650611 GGCTGGACCCACTCCAGATGAGG - Intronic
1121463608 14:94100467-94100489 GGCTGGGCCCCCTGCAGCACTGG - Intronic
1121940370 14:98064610-98064632 GGGTGGGCTCCCTGCAGATAGGG + Intergenic
1122834799 14:104425390-104425412 GGCAGGACACCCTGCAGCACCGG + Intergenic
1125525732 15:40373057-40373079 GGCTGGATTTCCTGCTGATGTGG - Intergenic
1127609232 15:60620978-60621000 GACTAGACTCCCTGAAGAGCTGG - Intronic
1128116574 15:65111102-65111124 AGCTGGTCTCCCTGCACAGCAGG + Intronic
1128716874 15:69914992-69915014 GGCTGGAGCCCCAGCAGACCCGG - Intergenic
1129673356 15:77619304-77619326 GGGTGGAAGCCCTGCAGATGGGG + Intronic
1130823252 15:87517433-87517455 GGCTGGATCACCTGCACATCAGG - Intergenic
1132857833 16:2054949-2054971 GGCTGGGCTGCCTGCAGGACAGG + Intronic
1132889128 16:2195727-2195749 GGCTGGACTCCAGGCAGGGCCGG - Intronic
1138915283 16:61455887-61455909 GTATGTACTACCTGCAGATCTGG + Intergenic
1139528315 16:67529538-67529560 GCCTGGGCTCTCTGCAGAACTGG + Intronic
1139532187 16:67547833-67547855 GGCAGGGCTCCCTGGGGATCTGG - Intergenic
1140196553 16:72860214-72860236 AGCTGGTCCCCCTGCAGAGCTGG + Intronic
1140450010 16:75063277-75063299 GAAGGCACTCCCTGCAGATCAGG - Intronic
1141353059 16:83316891-83316913 GGCTGGGCTCCAGGCTGATCTGG + Intronic
1141512216 16:84519739-84519761 GGCTGGAACCCCGGCAGCTCTGG + Intronic
1141664335 16:85458183-85458205 TTCTGGACCCCCTGCAGCTCTGG + Intergenic
1142381030 16:89732318-89732340 GGCTGGGCTCCCTGCAGTGGAGG + Intronic
1143649370 17:8254028-8254050 GTCTCGACGCCCTGCAGCTCTGG - Exonic
1143779823 17:9223588-9223610 GGATGCAGTCCCTGCAGCTCCGG - Intronic
1144500878 17:15786301-15786323 GGCTCGATTCCCCGCAGAGCCGG + Intergenic
1144676790 17:17167180-17167202 GCCAGGACTCCTTGCAGAGCTGG - Intronic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147978386 17:44260595-44260617 TTCTGGACCCCCTGCAGATGAGG - Intronic
1148776555 17:50099046-50099068 GGTTGGGCTCCATGAAGATCAGG - Intronic
1148852586 17:50561997-50562019 AGCTGGACGCCCTCCAGATGTGG + Intronic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150300537 17:64043888-64043910 GCCTGGTCTCCCTGCAAAGCCGG + Exonic
1151681283 17:75624158-75624180 GGCTGGCTTCTCTGCAGAGCTGG + Intergenic
1156501342 18:37561146-37561168 GGCTGAAATCCCTGCAGCTGTGG + Intronic
1158405354 18:57155119-57155141 GGCTGGGCTCACTGCAGAAGGGG - Intergenic
1160546779 18:79662722-79662744 GGCTGGAATCCCAGCACACCAGG - Intergenic
1161321571 19:3643954-3643976 GGCAGGCGGCCCTGCAGATCCGG + Intronic
1162019035 19:7860406-7860428 GGCTGGACCCCCTGATGCTCAGG - Intronic
1163156732 19:15443822-15443844 GGATGGGCTCTCTGCAGCTCAGG - Intronic
1163234868 19:16024354-16024376 TGCTGGACATGCTGCAGATCAGG + Intergenic
1163640428 19:18458884-18458906 GGCTGGAATCCCAGCACATTGGG - Intronic
1166875756 19:45896328-45896350 GGCTGGACTCCCAGCAGTCAGGG - Intronic
1166931547 19:46304278-46304300 GGCGGGACTCCCAGCAGGCCAGG - Intronic
1167985222 19:53308815-53308837 GGCTGCACTGCCTCCAGCTCTGG - Intergenic
1168224137 19:54982430-54982452 GGCTGAGCTCCCTGCAGCTGAGG - Exonic
1168243290 19:55097800-55097822 GGCTGGTCTCCCCCCATATCTGG + Intronic
925142914 2:1562315-1562337 GGCTGGACGCCCTGCAGGGAGGG + Intergenic
925180094 2:1811871-1811893 AGCAGGACGCCCTGCAAATCCGG + Intronic
925495886 2:4448553-4448575 GGGTGGAGTCACTGCAGAGCTGG - Intergenic
930256674 2:49101343-49101365 GGGTGGAGTCCCTCCAGAACTGG + Intronic
934928245 2:98397077-98397099 CCCTGGACACCCTGCAGACCAGG + Exonic
936405838 2:112201580-112201602 CTCTGGACTGCCTGCAGTTCTGG - Intergenic
938063966 2:128271221-128271243 GGCTTGGCACCCTGCAGATGGGG + Intronic
938383344 2:130848735-130848757 GCCTGGTCTCCCTGCAGACCGGG - Intronic
946179892 2:217942841-217942863 GGCTGGGCTCCCTGCAGGGGAGG - Intronic
946199788 2:218064883-218064905 GGCTGGGCTCCCTGCAGGGGAGG - Intronic
948813886 2:240499875-240499897 GGCTGTTATCCCTGGAGATCTGG - Intronic
948942272 2:241202496-241202518 GGCTGCAGTCCCCGCAGAGCCGG - Intronic
1169273644 20:4218748-4218770 GGCTGCATTCCCAGGAGATCAGG + Intergenic
1171321270 20:24246623-24246645 GGCTGGCCACCCTACAGATTGGG - Intergenic
1175414771 20:58794190-58794212 GGCTGGACTCGCTGCAGCTGCGG + Intergenic
1175943315 20:62547737-62547759 GGCTGGTGCCCCTGCAGACCTGG - Intergenic
1179441691 21:41399348-41399370 GGCAGGGCTCCCTGCAAAACAGG + Intronic
1180051021 21:45331022-45331044 GGGTGGACTCCCATCAGGTCAGG + Intergenic
1181064371 22:20298781-20298803 GGCTGGATTCTCAGCCGATCCGG + Intergenic
1181882445 22:25991826-25991848 AGCTGGGCTCCCTCCAGAACAGG - Intronic
1185231473 22:49686612-49686634 GCCTGGACTGCCTCCGGATCCGG - Intergenic
1185231613 22:49687126-49687148 GGCCAGACTCCCTGCAGACCTGG + Intergenic
949446457 3:4139832-4139854 GGCTGGAATCATTGCAGAACTGG - Intronic
950229689 3:11265759-11265781 GGCTGCACTCCCAGGAGGTCAGG + Intergenic
952179922 3:30906823-30906845 GGCTGCATTCCCAGGAGATCAGG - Intergenic
952456953 3:33482131-33482153 GGCTGGAGTCCCAGAAGATCTGG + Intergenic
954069906 3:48135338-48135360 GGCTGCACTCACTGCAGAGTGGG - Intergenic
954801893 3:53192024-53192046 GGCTGGAGTCCCTGCAGGGCTGG - Intronic
956003626 3:64755053-64755075 GGCAGGACAGCCCGCAGATCAGG + Intergenic
964918609 3:161867872-161867894 GACTGGGCTTCCTGAAGATCTGG - Intergenic
968004871 3:195235968-195235990 GGCTGGGCTGCCTGGAGATTGGG + Intronic
968569495 4:1331984-1332006 GGCTGGACTCCCTGCAGATCCGG - Intronic
969716016 4:8868470-8868492 GGCTGGGCACCCAGCAGCTCTGG + Intronic
972670203 4:41207795-41207817 GGCAGGCCTCCCTGCATCTCAGG + Intronic
981315156 4:143334706-143334728 GGCGGAACTTCTTGCAGATCTGG - Intergenic
984811762 4:183801633-183801655 GGCGGGAGTTCCTGCAGAGCAGG + Intergenic
984966045 4:185141378-185141400 GCCTGGAATCCCAGCAGCTCAGG - Intergenic
987278900 5:16392360-16392382 GCCTGGAATACCTGCAGATTGGG - Intergenic
991435831 5:66596524-66596546 GGCGGGGCTCCCTGCAGCCCGGG + Exonic
992023116 5:72644434-72644456 CTCTGGTCTCCCTGCAGCTCAGG - Intergenic
997360479 5:133291656-133291678 GTCTGACCTCTCTGCAGATCAGG - Intronic
998502281 5:142644125-142644147 GGCTGGCTTCCCTGCAGAAGTGG + Intronic
1000297035 5:159921133-159921155 GGTTGGGCTGCCTGCAGAGCAGG + Intronic
1002085055 5:176769453-176769475 GGCTGGAGACCCAGCAGACCAGG + Intergenic
1002315083 5:178338286-178338308 CTCTGGACTTCCTGGAGATCAGG - Intronic
1002710512 5:181192163-181192185 ATCTGGACTCCCTGCAGGACGGG - Intergenic
1003178389 6:3771365-3771387 GGCAGGACTACGTTCAGATCTGG + Intergenic
1004512144 6:16291784-16291806 GACTGTACTCCCAGCAGCTCAGG + Intronic
1006516370 6:34547908-34547930 GGTTCGACTCTCTGCAGATCAGG + Intronic
1007408263 6:41647109-41647131 AGCTGGACTCCCTGGAAGTCAGG + Intronic
1015756051 6:136607986-136608008 GGCTGGTCTCACTGCAGAGGTGG + Intronic
1015817693 6:137227477-137227499 GGCTGGACTGCCTGCATTTAGGG + Intergenic
1015905928 6:138116421-138116443 GGCTGAACTCCCTTGAGCTCAGG - Intergenic
1018859304 6:167699181-167699203 AGCTGGCCTCCCTGCAGCTGGGG - Intergenic
1019502074 7:1369454-1369476 GGCTGGAGTCGCTGCCGGTCAGG - Intergenic
1019705946 7:2497489-2497511 GGCTCTTCTCCCTGCAGGTCCGG - Intergenic
1021030959 7:15735214-15735236 GGCTGGCCACCCTGCAGACTGGG + Intergenic
1021032472 7:15754847-15754869 GGCTGTAATCCCAGCAGATTGGG + Intergenic
1029374184 7:100168136-100168158 GGCTGGACTCCCGGTTGATTAGG - Intronic
1033705109 7:143879009-143879031 GTGTGGACTGCCTGCAGAGCTGG + Intronic
1035305020 7:157926607-157926629 GGCGGGACTCCCTGCATCCCAGG + Intronic
1037806955 8:22063336-22063358 GGCTGGTCTCCCGGCAGACCTGG + Intronic
1041895117 8:62915464-62915486 GGCTGTACTCCTGGAAGATCTGG - Intronic
1041918041 8:63155509-63155531 GGCTGCACTCCCAGGAGGTCAGG - Intergenic
1042712873 8:71737608-71737630 TGCTGGCCTCCCTGAAGAACAGG - Intergenic
1045757775 8:105566036-105566058 GACTGGCCTCCCTGCAGACGAGG - Intronic
1047760877 8:127953250-127953272 GGGTGATCTCCCAGCAGATCGGG - Intergenic
1049152176 8:141042044-141042066 GGGTGGCCTTCCTGCTGATCTGG + Intergenic
1049526590 8:143129934-143129956 GGCGGGACTTCCTGCAAATGTGG + Intergenic
1049707114 8:144048107-144048129 GGCTGGATTCCCTGGAGGTCTGG - Intergenic
1049738704 8:144223774-144223796 TGCTTGAGTCCCTGCAGCTCTGG + Intronic
1049999043 9:1056739-1056761 GGATGGACTCAGTGCAGAGCAGG + Exonic
1053859351 9:42371260-42371282 ATCTGGGCTCACTGCAGATCTGG + Intergenic
1057504369 9:95620437-95620459 GGCTGGCCTCCCTGCAGCTGAGG + Intergenic
1057835906 9:98445207-98445229 GGCTGTGGTCCCTGCAAATCTGG + Intronic
1059651438 9:116319378-116319400 GGCTGTACTGTCTGCAGAACGGG + Intronic
1059657782 9:116371805-116371827 GGGAGGACTCCCTGAAGATTTGG - Intronic
1060057467 9:120427104-120427126 GGCAGGACACCCTTCAAATCAGG + Intronic
1060152602 9:121298486-121298508 GGCTGGACTTCCGGAAGAGCTGG + Intronic
1061071056 9:128311013-128311035 GGTTGGAGTACCTGCAGATCAGG + Exonic
1061665879 9:132161062-132161084 CTCTGCACTCCCTGCAGAGCTGG + Intergenic
1061855216 9:133438265-133438287 GGATGGACTCCCAGCAGGTATGG + Exonic
1062416773 9:136455184-136455206 GACTTGACTCCCTGGAGCTCTGG + Intronic
1062578013 9:137217566-137217588 GGCTGGGCTCCAGCCAGATCTGG + Intergenic
1185955489 X:4484438-4484460 GGCTGCATTCCCTGAAGGTCTGG + Intergenic
1187618215 X:21021141-21021163 TGCTGGACTGCCTGTAGCTCGGG - Intergenic
1192858460 X:75039683-75039705 GGCAGTACTCCCTGCAGGCCTGG - Intergenic
1197865022 X:131008297-131008319 AGCTGGTCCCCCTGCAGCTCTGG + Intergenic
1198646940 X:138818704-138818726 GGCTGGATTCCCTAAAGATTTGG + Intronic
1201075307 Y:10182250-10182272 GGCTGAAATCCCGGCAGCTCAGG - Intergenic
1201706870 Y:16947423-16947445 GGCTGCATTCCCTGGAGATCTGG + Intergenic
1201963326 Y:19706464-19706486 GGCTGGACAGCCTCCAGACCTGG - Exonic