ID: 968571930

View in Genome Browser
Species Human (GRCh38)
Location 4:1346658-1346680
Sequence CGGGGCGAGCTCGGGGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 738
Summary {0: 1, 1: 0, 2: 3, 3: 79, 4: 655}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968571909_968571930 24 Left 968571909 4:1346611-1346633 CCCGAGGCCGGAGCGGGGAGGCG No data
Right 968571930 4:1346658-1346680 CGGGGCGAGCTCGGGGGCGGGGG 0: 1
1: 0
2: 3
3: 79
4: 655
968571905_968571930 29 Left 968571905 4:1346606-1346628 CCCTTCCCGAGGCCGGAGCGGGG No data
Right 968571930 4:1346658-1346680 CGGGGCGAGCTCGGGGGCGGGGG 0: 1
1: 0
2: 3
3: 79
4: 655
968571907_968571930 28 Left 968571907 4:1346607-1346629 CCTTCCCGAGGCCGGAGCGGGGA No data
Right 968571930 4:1346658-1346680 CGGGGCGAGCTCGGGGGCGGGGG 0: 1
1: 0
2: 3
3: 79
4: 655
968571912_968571930 17 Left 968571912 4:1346618-1346640 CCGGAGCGGGGAGGCGCCGCGGG No data
Right 968571930 4:1346658-1346680 CGGGGCGAGCTCGGGGGCGGGGG 0: 1
1: 0
2: 3
3: 79
4: 655
968571917_968571930 1 Left 968571917 4:1346634-1346656 CCGCGGGGTTCAGGGCGCCCTGC No data
Right 968571930 4:1346658-1346680 CGGGGCGAGCTCGGGGGCGGGGG 0: 1
1: 0
2: 3
3: 79
4: 655
968571910_968571930 23 Left 968571910 4:1346612-1346634 CCGAGGCCGGAGCGGGGAGGCGC No data
Right 968571930 4:1346658-1346680 CGGGGCGAGCTCGGGGGCGGGGG 0: 1
1: 0
2: 3
3: 79
4: 655

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968571930 Original CRISPR CGGGGCGAGCTCGGGGGCGG GGG Intergenic
900100781 1:961126-961148 CACGGCGCGCTCCGGGGCGGGGG + Intronic
900119147 1:1041117-1041139 CGGGGCGGGAGCGGGGGCGGGGG + Intronic
900191797 1:1355209-1355231 GGGCGGGAGCTGGGGGGCGGGGG + Intronic
900204951 1:1427733-1427755 CGGGGCGCCCCGGGGGGCGGCGG - Exonic
900214008 1:1471640-1471662 AGGAGCGTGCTCCGGGGCGGCGG - Intergenic
900307794 1:2019512-2019534 CGGCGCGGGGTCGGGGGCGGTGG + Intronic
900335149 1:2159115-2159137 CGGGGTGAGCTCCGGGTTGGGGG + Intronic
900349744 1:2228686-2228708 CGGGGCGCGCGGGGCGGCGGCGG + Exonic
900366956 1:2315270-2315292 GGGGGCGGGGGCGGGGGCGGGGG + Intergenic
900366958 1:2315276-2315298 GGGGGCGGGGGCGGGGGCGGCGG + Intergenic
900461807 1:2805344-2805366 CAAGAGGAGCTCGGGGGCGGGGG - Intergenic
900787107 1:4655826-4655848 CGCGGCGGGCGCGGGGGCCGGGG + Intronic
901109952 1:6785918-6785940 CGCAGCGGGCTCGGGAGCGGCGG - Intronic
902286118 1:15409804-15409826 CCGCGCGGGCCCGGGGGCGGGGG + Intergenic
902785546 1:18730662-18730684 CGGGGCCAGCTCAGGAACGGAGG + Intronic
903176981 1:21587240-21587262 CGGGGAGGGCTCGGAGGCCGTGG + Intergenic
903780943 1:25819853-25819875 CGGGTCCAGCTCGGTGGCGAGGG - Intronic
903851159 1:26306819-26306841 CGGGGCGGGGTGGGGGGGGGGGG + Intronic
904237601 1:29124700-29124722 GGGGGCGGGTTCGGGGGAGGCGG + Intergenic
904837727 1:33349815-33349837 CGGGGCGGGAGCGCGGGCGGCGG + Intronic
905189753 1:36224423-36224445 CTGGGCGCGCTGTGGGGCGGGGG + Exonic
905414216 1:37793776-37793798 CGCGGCGGGGGCGGGGGCGGAGG - Intergenic
905442789 1:38005578-38005600 CGCGGCGGGCTGGGGGGCCGGGG - Intronic
906488163 1:46247490-46247512 CGGGGCGGGGGCGGGGGTGGCGG - Intergenic
906614568 1:47225568-47225590 CGAGGCGGGCGCGGGGGCCGGGG + Exonic
906615833 1:47232245-47232267 CGGGGCGGGCGGGGGAGCGGGGG - Intergenic
907296553 1:53459704-53459726 CGGGACGGGGACGGGGGCGGGGG - Exonic
908401134 1:63774061-63774083 CGGGGCTCCCTCGGCGGCGGCGG - Exonic
908572070 1:65420621-65420643 CGGGGCGGGCTCGGGATCCGCGG + Exonic
909958051 1:81802208-81802230 CGGGGCGCGCTCGCAGACGGAGG + Intronic
912185507 1:107270697-107270719 GGGGGCGGGGGCGGGGGCGGGGG - Intronic
912568896 1:110607507-110607529 GGTGACGAGCTCGGTGGCGGCGG - Intronic
914902889 1:151721398-151721420 AGGGGTGAGCTCCGGGGCGGGGG - Intronic
915238272 1:154501842-154501864 CGGGCCAAGCCCGGGGGCGGCGG - Exonic
915310568 1:155004054-155004076 CGGGGCGCCCTGGGGGGCAGGGG + Intronic
915439248 1:155934289-155934311 CGGAGCGAGCACTGGGGCGCAGG - Intronic
917629684 1:176879570-176879592 TTGGGCCAGCTTGGGGGCGGGGG - Intronic
917962292 1:180154760-180154782 TGGGCCGGCCTCGGGGGCGGGGG + Intergenic
917962302 1:180154774-180154796 GGGCGGGGGCTCGGGGGCGGGGG + Intergenic
919712067 1:200738824-200738846 CGGGGAGGGGGCGGGGGCGGGGG + Intergenic
919712071 1:200738830-200738852 GGGGGCGGGGGCGGGGGCGGGGG + Intergenic
922116324 1:222617955-222617977 GGGGGCGGGGACGGGGGCGGGGG - Intergenic
922499056 1:226083555-226083577 CGTGGCGAGCTCCGGGGGCGTGG - Intergenic
922766392 1:228158675-228158697 CGGCGCGGGGGCGGGGGCGGAGG - Exonic
922937316 1:229432500-229432522 GGGGGCGGGGGCGGGGGCGGGGG + Intronic
923055900 1:230425937-230425959 GGGGGCGGGCGCGCGGGCGGCGG - Intergenic
923400781 1:233614079-233614101 CCGGGCGGGGGCGGGGGCGGCGG + Exonic
924289661 1:242524524-242524546 GGGGGCGGGGGCGGGGGCGGAGG + Intronic
924414951 1:243849769-243849791 CGGGGAAAGCTGGGGGGCGGCGG - Intronic
924436559 1:244048611-244048633 GGGGGCGGGCGCGGGGGAGGGGG - Intergenic
1063418236 10:5890296-5890318 CGGCGCGGGCCCGGCGGCGGCGG + Intronic
1064542010 10:16414798-16414820 TGGGGGGAGCTGGGGGTCGGAGG - Intergenic
1064645102 10:17453243-17453265 GGTGGCGGGGTCGGGGGCGGGGG + Intronic
1065025394 10:21535116-21535138 CGGGGTGGGGGCGGGGGCGGGGG + Intronic
1065025398 10:21535122-21535144 GGGGGCGGGGGCGGGGGCGGGGG + Intronic
1065099569 10:22320743-22320765 CGGGGCCGGCCGGGGGGCGGCGG + Intronic
1065101987 10:22340674-22340696 GGGGGCGAGCCCGGAGCCGGCGG - Intergenic
1065102074 10:22340950-22340972 CGGGGCGGACCCGGGTGCGGCGG - Intergenic
1065214845 10:23439405-23439427 CGCGGCGAGCCCCGGAGCGGGGG - Intergenic
1065590347 10:27256752-27256774 CGGGGCGGGAGCGGGGGTGGGGG - Intergenic
1065590361 10:27256776-27256798 CGGGGCGGGAGCGGGGGTGGGGG - Intergenic
1065590375 10:27256800-27256822 CGGGGCGGGAGCGGGGGAGGGGG - Intergenic
1065590387 10:27256820-27256842 CGGGGCGGGAGCGGGGGGGGCGG - Intergenic
1066126468 10:32347205-32347227 CGGCGCGGGCACGCGGGCGGGGG + Intronic
1066180603 10:32958002-32958024 GGGGGCGGGGGCGGGGGCGGGGG - Intronic
1067096533 10:43305049-43305071 GGGGGCGGGGGCGGGGGCGGGGG - Intergenic
1067096537 10:43305055-43305077 GGGGGCGGGGGCGGGGGCGGGGG - Intergenic
1067336948 10:45374102-45374124 GGGGGCGGGGGCGGGGGCGGGGG + Intergenic
1067336952 10:45374108-45374130 GGGGGCGGGGGCGGGGGCGGGGG + Intergenic
1067336956 10:45374114-45374136 GGGGGCGGGGGCGGGGGCGGGGG + Intergenic
1067372597 10:45699321-45699343 CGGGTTGAGCTTGGGGCCGGTGG - Intergenic
1068845161 10:61663230-61663252 CGGGGCCGGCTGGGGGGCGCCGG - Intronic
1070112082 10:73495920-73495942 CCGGGCGGGGTTGGGGGCGGGGG + Exonic
1072719506 10:97771943-97771965 CTGGGCGACCTCCGCGGCGGCGG - Exonic
1072783991 10:98268242-98268264 CGCGGCCAGCTCGGGGCTGGGGG - Exonic
1072784075 10:98268411-98268433 CGGGGGGAGCGGGGGGGCGGCGG + Intergenic
1073043238 10:100621502-100621524 CTGGGCGGGGGCGGGGGCGGGGG - Intergenic
1073123457 10:101135489-101135511 CAGGGCTAGCTCGGGGGTTGGGG + Intronic
1073242466 10:102067247-102067269 CGGGCCGGGCTGGGGGGCAGGGG + Exonic
1073465661 10:103693296-103693318 CGGGGCGGGCTGGGGCGGGGCGG - Intronic
1075519961 10:123137245-123137267 CGGGGCGAGCGTAGGGGCGGCGG + Exonic
1075871313 10:125774115-125774137 GGGGGCGGGCCCGGGGGCGAAGG + Exonic
1076374058 10:129971900-129971922 CGGGGCGAGGGCGGCGGCGGCGG - Intergenic
1076726625 10:132416918-132416940 CGGCAGGAGCTGGGGGGCGGTGG + Intronic
1076792877 10:132786097-132786119 CGGGGCGGGCGGGCGGGCGGCGG + Intergenic
1076864498 10:133160289-133160311 CGGGGCGGGCCCGGGGGGCGCGG - Intergenic
1076869822 10:133187874-133187896 GGGGGCGGGCTCGGGGGTTGGGG - Intronic
1077065704 11:640136-640158 CGGGGGGAGGCCGGGCGCGGGGG - Exonic
1077074889 11:695843-695865 CGAGGTGAGCTCGGGCGGGGTGG + Exonic
1077090720 11:777202-777224 CGGGGCGGGGACGGGGGCGGGGG - Intronic
1077098572 11:810504-810526 CGGGCGGAGGTCGGGCGCGGTGG + Intronic
1077103847 11:833447-833469 CCGGGCGGGGTCGGCGGCGGCGG + Intronic
1077413694 11:2414870-2414892 CGGGCCCAGCGCGGGGGCAGGGG - Intronic
1077469034 11:2748280-2748302 CAGGGTGAGCTAGGGGGTGGGGG - Intronic
1077637837 11:3855623-3855645 CGGGGCGGGCCCGGGGCGGGCGG - Intronic
1078180015 11:9003734-9003756 CGGGGCGAGAACGGCGGCGGGGG + Intronic
1078514103 11:12008508-12008530 CGGAGCGGGCGCGGGGGCCGTGG + Exonic
1080036543 11:27718527-27718549 GGGGCTGAGCTTGGGGGCGGGGG - Intronic
1080385530 11:31808882-31808904 CGGGCTGAGCTGGGGGGCTGAGG - Intronic
1080503868 11:32893456-32893478 CTCGGCCAGCTCGGGGGAGGCGG + Intronic
1080515520 11:33016061-33016083 CGGGGCGGGCTGGGGTGCGCGGG + Intronic
1081207563 11:40293198-40293220 GGGGGCGGGGGCGGGGGCGGGGG + Exonic
1081207565 11:40293204-40293226 GGGGGCGGGGGCGGGGGCGGAGG + Exonic
1081831914 11:46121547-46121569 GGGGGCGCGCACGGCGGCGGCGG - Intergenic
1081981707 11:47270497-47270519 CGGGGCGGGGGCGGGGGCGGGGG + Intronic
1083329656 11:61891608-61891630 CGGGGCCTGGCCGGGGGCGGGGG - Intronic
1083419638 11:62545814-62545836 CGGGCCAGGCTCTGGGGCGGGGG + Intronic
1083571369 11:63763737-63763759 CGGGGCGGGGGCGGAGGCGGGGG + Exonic
1083659808 11:64246783-64246805 CGCGGCGAGGGCGGCGGCGGGGG + Exonic
1084053616 11:66617065-66617087 GGAGGCGCGCTCGGGGGCGGGGG + Intronic
1084145219 11:67261618-67261640 GAGGGCGAGGGCGGGGGCGGGGG + Intergenic
1084165303 11:67372614-67372636 CGCGGCGGGGGCGGGGGCGGGGG + Intronic
1084165307 11:67372620-67372642 GGGGGCGGGGGCGGGGGCGGGGG + Intronic
1084265607 11:68003860-68003882 CGGGGCGGGCCGGGGGGCGGCGG - Intronic
1084892686 11:72244235-72244257 CGGGGCGAGCTCCGAAGGGGCGG + Intronic
1084968094 11:72754843-72754865 CCGGGCGAGCCCTGGGGCGGCGG - Exonic
1085190882 11:74621390-74621412 CGGTGGGGGGTCGGGGGCGGTGG - Intronic
1085321555 11:75577326-75577348 GGGGGCGGGGGCGGGGGCGGGGG - Intergenic
1085321559 11:75577332-75577354 TGGGGCGGGGGCGGGGGCGGGGG - Intergenic
1087014517 11:93542918-93542940 CGGGGCGGACTCAGGGGCCGGGG - Intronic
1089103990 11:115987006-115987028 CTGGGAGTGCTTGGGGGCGGAGG - Intergenic
1089494983 11:118903296-118903318 GGGGGCGGGGGCGGGGGCGGGGG - Exonic
1090194083 11:124800197-124800219 TGCGGCGGGCTCGGGGGCAGCGG - Exonic
1090211030 11:124921232-124921254 CCGGGCGAGCTCGGGGCCCTGGG + Exonic
1090699181 11:129279247-129279269 CGGGCGGCGCTCGGCGGCGGCGG - Intronic
1091220078 11:133925522-133925544 CGGGGCCAGCTCTGGGGCAGCGG - Intronic
1091286572 11:134411774-134411796 CGGGGCGCCCGCGGGGGCGCGGG + Intronic
1091616199 12:2052920-2052942 AGGGGCGGGCGCGGGCGCGGCGG + Intronic
1091823113 12:3491077-3491099 GGGGGCGGGCCCGGGGGCGCTGG + Intronic
1092861894 12:12725641-12725663 CCGGGCGGGCGCGGGGGCTGGGG - Intergenic
1093711574 12:22334708-22334730 CGGGGCGGGGTGGGGGGGGGGGG - Exonic
1094514837 12:31120319-31120341 CCGGGCGGGGTCGGGGGGGGCGG - Intergenic
1094536067 12:31324089-31324111 CGGGGCGAGGGCGAGGGCAGCGG + Intronic
1095432022 12:42144671-42144693 CGGGGCGGGCGCGGCGGCGGCGG - Exonic
1096260141 12:50085297-50085319 CGGGGGGCGCTCGGGGGGCGGGG + Exonic
1096336942 12:50764055-50764077 GGGGGCGGGGGCGGGGGCGGGGG - Intronic
1096396444 12:51270021-51270043 CGGGGCGGGGGCGGGGACGGGGG - Intronic
1096466305 12:51848961-51848983 CTGGGCGAGCCCAGGGGAGGTGG - Intergenic
1096747857 12:53739954-53739976 GAGGGCGAGGGCGGGGGCGGGGG + Intergenic
1096747870 12:53739979-53740001 GAGGGCGAGGGCGGGGGCGGGGG + Intergenic
1098426020 12:70366396-70366418 CGGGGAGAGTGCGGGGGCGGAGG + Exonic
1098893507 12:76032126-76032148 CTGGGCGAGCTGGGAGGCCGGGG + Exonic
1099173417 12:79392957-79392979 GGGGGCCTGCTCGGGGGTGGGGG - Intronic
1099315533 12:81078247-81078269 CGGGGCGGTCTCGGGGGCCGGGG + Exonic
1099637023 12:85226683-85226705 CGGGGCCTGCTGGGGGGTGGGGG - Intronic
1100391751 12:94150110-94150132 GGGGGCGAGCGGCGGGGCGGGGG + Intronic
1100444749 12:94650325-94650347 CGCAGCGGGCTGGGGGGCGGCGG - Intronic
1100468810 12:94873092-94873114 TGGGGCGCCCTCGGGGGCTGCGG - Intergenic
1101131815 12:101697821-101697843 CGGGCTGCGCTCGGTGGCGGCGG + Exonic
1102151024 12:110689189-110689211 GGGGGCGGGGACGGGGGCGGGGG - Intronic
1103325507 12:120117263-120117285 CGGGGCCAGCTCCGCGGGGGAGG - Intronic
1103920474 12:124396729-124396751 CGGGGTGAGGGCGGGGGCTGTGG + Intronic
1104177529 12:126347640-126347662 CGGGGTGAGCTCTGGGGATGCGG - Intergenic
1104376181 12:128267093-128267115 CGGGGCCCGGGCGGGGGCGGGGG + Intergenic
1104448838 12:128853527-128853549 CGGGGCCTGGTCGGCGGCGGCGG + Exonic
1104709078 12:130972642-130972664 CGGCGTGAGCTCGGTGGCAGGGG + Intronic
1104761202 12:131298585-131298607 CGGGGGCATCTGGGGGGCGGCGG + Intergenic
1104818573 12:131662207-131662229 CGGGGGCATCTGGGGGGCGGCGG - Intergenic
1104859584 12:131917303-131917325 TGGGGGGAGCTCGGAGGCCGTGG + Intronic
1105502888 13:20988343-20988365 CGGGGCGGGGGCGGGGGCGGGGG + Exonic
1105937736 13:25117601-25117623 CGGGGGCAGCACTGGGGCGGGGG - Intergenic
1105937934 13:25119102-25119124 CTGAGCGAGCTCGTGGGCGTCGG - Intergenic
1106995038 13:35471256-35471278 CGGGCCGGGCTCGGGAGAGGCGG - Intronic
1108292714 13:48976584-48976606 GGGGGCGGGGGCGGGGGCGGGGG + Intronic
1109126815 13:58528454-58528476 CGGGGGGAGCTGGGGGACGCGGG - Intergenic
1109884406 13:68524204-68524226 GGGGGGGAGCTCGGGCACGGTGG - Intergenic
1110318197 13:74134282-74134304 GGGGCCGAGGGCGGGGGCGGCGG + Intergenic
1110572935 13:77026529-77026551 CGCGGCGAACCCGGGAGCGGCGG + Intronic
1113312034 13:109140998-109141020 CCGGGCGGGGGCGGGGGCGGGGG - Exonic
1113378817 13:109785571-109785593 CGCGGCGGGCGCGGCGGCGGGGG + Exonic
1113707809 13:112445634-112445656 CGGGGAGAGCCCGGGGAGGGAGG - Intergenic
1113962324 13:114132774-114132796 CGGGGCGGGGGCGGGGGCCGAGG - Intergenic
1114485173 14:23057659-23057681 CGCGGCGGGGGCGGGGGCGGAGG + Intergenic
1115474565 14:33800600-33800622 GGGGGCGGGGGCGGGGGCGGCGG + Exonic
1115557369 14:34554100-34554122 CGCGGGGAGGTGGGGGGCGGGGG + Intergenic
1115851782 14:37595133-37595155 CGCGGCGTGCGCGGCGGCGGCGG + Intronic
1116003357 14:39267298-39267320 CGGGGGGAGCTGGGGGACAGGGG - Exonic
1116861792 14:50001333-50001355 CGGGGCGGGGGCGGGGGCGGGGG + Intronic
1116861796 14:50001339-50001361 GGGGGCGGGGGCGGGGGCGGGGG + Intronic
1117875765 14:60249156-60249178 CGGGGCGAGCGGAGGGGTGGGGG + Intronic
1117980810 14:61340373-61340395 GGGGGCGGGGTGGGGGGCGGGGG + Intronic
1118270533 14:64338686-64338708 CGGGGCGGCCTCGCGGGGGGTGG - Intergenic
1118776782 14:68978623-68978645 TGGGCTGTGCTCGGGGGCGGTGG - Intronic
1119003980 14:70907798-70907820 CGGGGCGGGGACGGCGGCGGCGG + Exonic
1119286384 14:73458344-73458366 CGGGGCCAGGGCGGAGGCGGCGG - Intronic
1119456801 14:74763327-74763349 CGGGCCCAGCTCGGGAGCGCCGG + Intergenic
1120190556 14:81436226-81436248 GGGGGCGGGGGCGGGGGCGGGGG - Intronic
1121412289 14:93756528-93756550 CGGGGCGGGGTCGGGGTCCGGGG - Intronic
1122444941 14:101761567-101761589 CGGGGCGGGGCCGGGCGCGGGGG + Intergenic
1122620719 14:103056567-103056589 GGGGGCGGGGGCGGGGGCGGGGG + Intronic
1122719899 14:103716100-103716122 CTGGGAGAGAGCGGGGGCGGGGG - Intronic
1122895066 14:104752778-104752800 CGGGAAGAGCCAGGGGGCGGGGG - Intergenic
1122959452 14:105087760-105087782 CGGGGCGAGCTGGCGGGGGCGGG + Intergenic
1123037768 14:105478374-105478396 CGCGGCGCGGGCGGGGGCGGGGG + Intronic
1123037985 14:105479072-105479094 CGGGGCGGGGGCGGGGGCGGGGG - Intronic
1123068387 14:105629343-105629365 CGGAGCCAGCACGGGGGAGGTGG - Intergenic
1123072398 14:105648148-105648170 CGGAGCCAGCACGGGGGAGGTGG - Intergenic
1123092407 14:105747667-105747689 CGGAGCCAGCACGGGGGAGGTGG - Intergenic
1123898076 15:24848250-24848272 GGGGGCGGGGGCGGGGGCGGGGG + Intronic
1124013788 15:25860213-25860235 CAGTGAGAGATCGGGGGCGGGGG - Intronic
1124109484 15:26773051-26773073 CCGGGCCAGCGCGGCGGCGGCGG - Exonic
1124229623 15:27932474-27932496 AGGGCAGAGCTAGGGGGCGGTGG + Intronic
1124712946 15:32030401-32030423 GGGGGCGGGGACGGGGGCGGGGG + Intergenic
1125603510 15:40927941-40927963 CGGCGCGAACCCGGGGGAGGCGG - Intergenic
1126767001 15:52019434-52019456 CGCGGCGGGCCCGGCGGCGGCGG + Intronic
1126849887 15:52790433-52790455 CGCCGCGACCTAGGGGGCGGGGG - Intronic
1126851157 15:52798092-52798114 CACGGAGAGCTGGGGGGCGGGGG + Intergenic
1127117459 15:55742690-55742712 CAGGGCGAGAGCGGGGGCCGGGG + Intronic
1129082346 15:73052298-73052320 GGGGGCGGGGGCGGGGGCGGGGG - Intronic
1129189138 15:73927413-73927435 CGGCGTGGGCGCGGGGGCGGCGG + Exonic
1129190645 15:73935587-73935609 CGGGGAGGGCTCAGGGGCAGGGG + Intronic
1129423991 15:75451706-75451728 CGGGGCGGGGTCGGGGGAGTGGG - Intronic
1129468493 15:75737678-75737700 TGGGGCGGGGGCGGGGGCGGGGG + Intergenic
1129854029 15:78811529-78811551 CGGGGCGGGGCCAGGGGCGGGGG - Intronic
1130224412 15:82046313-82046335 TGCGGCGAGCGCGGGGGTGGGGG - Intergenic
1131097500 15:89665811-89665833 CGGGGCGGGCTCCGGGCCGGCGG + Exonic
1131180176 15:90233997-90234019 GGGGGCGGGCCCGGGGGTGGTGG - Exonic
1131257300 15:90871316-90871338 AGAGCCGAGCCCGGGGGCGGGGG + Intronic
1131367661 15:91853704-91853726 AGGGGCGATCGCGGCGGCGGCGG + Exonic
1131828750 15:96341152-96341174 GGGGGCGAGGGCGGGGGCGGGGG + Intergenic
1132370566 15:101295078-101295100 CGGGGTGAGTCCGGGGGCGTGGG - Exonic
1132606347 16:795383-795405 GGGGGCGGGCACGGGGCCGGGGG - Intronic
1132606365 16:795426-795448 GGGGGCGGGCACGGGGCCGGGGG - Intronic
1132606384 16:795473-795495 GGGGGCGGGCACGGGGCCGGGGG - Intronic
1132606403 16:795520-795542 GGGGGCGGGCACGGGGCCGGGGG - Intronic
1132606422 16:795567-795589 GGGGGCGGGCACGGGGCCGGGGG - Intronic
1132719484 16:1308927-1308949 CGGGGCGAGCCCGTGGGGGAGGG - Exonic
1132719661 16:1309518-1309540 CGGGGAGCGCTCGGCGGCGCGGG + Intronic
1132734721 16:1379697-1379719 CGGGGCCAGCGCGGAGGGGGCGG - Intronic
1132735899 16:1385778-1385800 CTGGGCGAGAGCCGGGGCGGGGG - Intronic
1132851509 16:2026946-2026968 GCGGGGGAGCTCGGGGGCGGCGG - Exonic
1132889491 16:2196775-2196797 CGGGGCGGGCGCGGGGAGGGCGG - Intergenic
1132942288 16:2514196-2514218 CGGGAGGGACTCGGGGGCGGGGG + Intronic
1132947138 16:2537960-2537982 CGGGGCGGCGCCGGGGGCGGGGG + Exonic
1133053867 16:3135100-3135122 GGGGGCGGGGGCGGGGGCGGGGG + Exonic
1134122528 16:11595375-11595397 CGGGGTGAGCTCATGGGCAGAGG + Intronic
1135480123 16:22814876-22814898 AGGGGCGGGCACGGCGGCGGCGG - Exonic
1136364789 16:29805043-29805065 CTGGGGGAGGGCGGGGGCGGGGG + Intronic
1136531814 16:30875104-30875126 CCGGGCGAGCTGGGGGCGGGCGG - Intronic
1136707667 16:32202515-32202537 TGGGGCGGGGACGGGGGCGGGGG + Intergenic
1136760243 16:32726895-32726917 TGGGGCGGGGACGGGGGCGGGGG - Intergenic
1136807861 16:33143491-33143513 TGGGGCGGGGACGGGGGCGGGGG + Intergenic
1137708003 16:50548586-50548608 CGGGGCGAGCGCGCGGGCGGGGG - Intronic
1138178597 16:54928376-54928398 CGGGGCGGGGGCGGGGGCGGGGG + Intergenic
1138178601 16:54928382-54928404 GGGGGCGGGGGCGGGGGCGGGGG + Intergenic
1139615445 16:68085757-68085779 GGCCGCGAGCCCGGGGGCGGCGG - Exonic
1139948952 16:70660098-70660120 CTGGGGGACCACGGGGGCGGAGG - Exonic
1140223128 16:73058229-73058251 CGGCCCGGGCTCGGCGGCGGCGG + Intronic
1141517486 16:84555543-84555565 GGAGGCGGGCTCGGGGGAGGAGG + Intergenic
1141538556 16:84700264-84700286 CGCGGCGGGCGCGGAGGCGGCGG - Intronic
1141957751 16:87383821-87383843 CGTGGCGAGCTCTGCGGCGGGGG - Intronic
1141972313 16:87492385-87492407 CCGGGCGGGCGCCGGGGCGGGGG + Intergenic
1141989559 16:87602414-87602436 GGGGGCGGGGGCGGGGGCGGGGG + Intronic
1141989563 16:87602420-87602442 GGGGGCGGGGGCGGGGGCGGGGG + Intronic
1142009310 16:87705789-87705811 CTGGGCGGGGGCGGGGGCGGGGG + Intronic
1142240375 16:88941920-88941942 GGGGGCGAGCGCGGGGCAGGGGG - Intronic
1142335891 16:89489829-89489851 CGGGGCGGGCCTGGGGGCCGTGG - Intronic
1142352735 16:89587336-89587358 CGGGGCGGGGGCGGGGGCGGGGG - Intronic
1203062397 16_KI270728v1_random:987217-987239 TGGGGCGGGGACGGGGGCGGGGG - Intergenic
1142549995 17:732541-732563 CGGGACGGGGACGGGGGCGGAGG + Exonic
1143320562 17:6065988-6066010 CAGGGCAGGCTCTGGGGCGGTGG + Intronic
1143749946 17:9021147-9021169 CCGGGGGAGCGCGCGGGCGGGGG - Intergenic
1143750051 17:9021480-9021502 GGAGGGGAGCGCGGGGGCGGGGG - Intergenic
1143781119 17:9230304-9230326 GGGGGCAAGCTCGGGAGAGGTGG - Intronic
1144107311 17:11997518-11997540 CGGGCGGAGCTAGGGGGCGGGGG + Intergenic
1145034832 17:19533789-19533811 CGGGGCGGGCTCTGGGCGGGCGG + Intronic
1146271364 17:31487955-31487977 CGGGGCGGGGGCGGGGGCGGAGG - Intronic
1146787425 17:35731944-35731966 CGGGCCGGGGTCGGGGGAGGAGG + Intronic
1147210472 17:38870113-38870135 CGAGGCGAGCTGGCGGGAGGCGG - Exonic
1147382216 17:40062769-40062791 CGGGGCGCGGCAGGGGGCGGGGG + Intronic
1147393122 17:40122203-40122225 TGAGGCGAGCTCCGGGGCGGGGG + Intergenic
1147683985 17:42276215-42276237 CGGGGCGAGCCCTGGGCCCGGGG - Intronic
1147909577 17:43847384-43847406 CGGGGCGGGCTGGGGGTGGGGGG + Intronic
1147967393 17:44200334-44200356 CCCGGCCGGCTCGGGGGCGGGGG + Intergenic
1149454967 17:56780419-56780441 CGGAGCGAGGGCGGGCGCGGGGG - Intergenic
1149541665 17:57472321-57472343 CAGGGCGAGCTCAGGGGCTGTGG + Intronic
1149728871 17:58924730-58924752 CGGGGCCAGTTGGGGGGTGGGGG - Intronic
1149772459 17:59332131-59332153 CGGGGCCAGGTTTGGGGCGGGGG + Intronic
1150003628 17:61456570-61456592 CAGCGCGGGCTCGGGGGCGTTGG - Exonic
1150137653 17:62704331-62704353 GGGGGCGAGGCCGGGGTCGGGGG + Intronic
1150249938 17:63699789-63699811 CGGGGCCAGGTCGGGGGCCGAGG - Intronic
1150373615 17:64662236-64662258 CGGGCGGTGCTCGGGGGCGCCGG + Intergenic
1151296906 17:73192827-73192849 GGGGGCGGGCGCGGGCGCGGGGG - Intronic
1151658738 17:75507889-75507911 CTGGGCCAGCTGGGAGGCGGGGG - Intronic
1151711417 17:75809088-75809110 GGGGGCGGGGGCGGGGGCGGGGG + Intronic
1151725048 17:75878657-75878679 CGGGCCGAGCTGGGGGCGGGCGG - Intergenic
1151919277 17:77141276-77141298 GAGGGCGAGCAGGGGGGCGGGGG - Intronic
1151919287 17:77141295-77141317 AGGGGCGAGCAGGGGGGCGGAGG - Intronic
1151954513 17:77373710-77373732 CGGCGCGGGCACGGGGCCGGGGG - Intronic
1151978032 17:77493270-77493292 CGGGGGGAGGTCTGGGGTGGAGG - Intronic
1152212481 17:79009766-79009788 CGGGGCGAGCGCGCGCGGGGCGG - Exonic
1152349689 17:79777924-79777946 CCGGGCGGGGGCGGGGGCGGGGG - Intergenic
1152357242 17:79813276-79813298 CGGGGCGAGCGGGGGAGGGGCGG - Intergenic
1152468473 17:80478086-80478108 CGGCGGGCGCTCGGGGGCTGGGG - Intergenic
1152632060 17:81414781-81414803 CGGGGTGAGGCTGGGGGCGGAGG + Intronic
1152697428 17:81804097-81804119 CAGGGCGAGGGCGGCGGCGGAGG - Intergenic
1152699684 17:81812760-81812782 CGGGCCGAGGGTGGGGGCGGTGG + Intronic
1152852814 17:82647976-82647998 CGGGCCGAGGTCGAGGTCGGTGG - Intronic
1152855606 17:82663433-82663455 CGGTTCCAGCTCTGGGGCGGTGG - Intronic
1152924481 17:83080859-83080881 GGGGGCGGGGGCGGGGGCGGGGG - Intronic
1152924485 17:83080865-83080887 CGCGGCGGGGGCGGGGGCGGGGG - Intronic
1153263775 18:3247964-3247986 CGGGGGCAGCTGGAGGGCGGCGG + Intronic
1153382489 18:4454958-4454980 TGGGGCGTGCGCGGCGGCGGCGG - Intronic
1153688157 18:7567085-7567107 CGGGGCGAGGAGGTGGGCGGGGG + Exonic
1155003665 18:21709027-21709049 CGTGGCGAGGCCGGGCGCGGTGG + Intronic
1155654573 18:28178005-28178027 GGGGGCGAGGGCGGCGGCGGCGG - Intergenic
1155954220 18:31943303-31943325 GGGGGCGGGGGCGGGGGCGGGGG + Intronic
1155954224 18:31943309-31943331 GGGGGCGGGGGCGGGGGCGGGGG + Intronic
1156099624 18:33578360-33578382 CGGGCCGGGGGCGGGGGCGGCGG - Intergenic
1156350427 18:36297650-36297672 CGGGGCGGGGGCGGGGCCGGCGG - Intergenic
1157279103 18:46334191-46334213 CGGGGCGCGGGCGCGGGCGGCGG - Intronic
1157376987 18:47176151-47176173 CGGGGCGCGGGCTGGGGCGGCGG - Intronic
1157610104 18:48950614-48950636 CGGGGCGCGCGCGGGGGCCCGGG + Exonic
1160024796 18:75208806-75208828 CGGGGCGAGAACGGGGGCGTGGG + Intronic
1160163966 18:76494876-76494898 CGGGGCGAGCGCCCGGGAGGTGG - Intronic
1160256233 18:77250601-77250623 CGGCCCGGGCTCCGGGGCGGGGG - Exonic
1160499692 18:79395700-79395722 CGGGGCGCGCACGGGGAGGGGGG - Intergenic
1160505183 18:79422923-79422945 GGGGGCTGCCTCGGGGGCGGGGG + Intronic
1160807898 19:1000673-1000695 CGAGGCGGGGTCGCGGGCGGGGG - Exonic
1160831932 19:1108300-1108322 GGGGGAGGGCGCGGGGGCGGGGG - Exonic
1160833621 19:1114403-1114425 CAGGGCGACCTCGGGGACGCGGG - Exonic
1160864291 19:1250271-1250293 CGGCGCGCGCTGGGGGGCTGGGG - Exonic
1160896938 19:1407546-1407568 CCGGGCGTGCGCAGGGGCGGCGG + Intergenic
1160992082 19:1864070-1864092 CGGGGCGCGCTCTGGGAGGGAGG - Intergenic
1161022097 19:2015445-2015467 GGCGGCGGGCCCGGGGGCGGCGG - Exonic
1161041587 19:2113348-2113370 GGGGGCGGGGGCGGGGGCGGGGG + Exonic
1161139050 19:2637214-2637236 CGGGCCGGGCTCGGGGGCGGGGG - Intronic
1161461567 19:4400590-4400612 GGGGGCGCGCGCGGGGGCCGGGG - Intergenic
1161478722 19:4500071-4500093 CGGTGGAGGCTCGGGGGCGGAGG + Intronic
1161664645 19:5568009-5568031 CGGGCGGAGCGCGGGCGCGGCGG - Intergenic
1161767716 19:6216373-6216395 CGGTGGGAGCCAGGGGGCGGAGG - Intronic
1161973377 19:7596129-7596151 CGGGCCGCGTTCGGGGGCGCAGG + Exonic
1162079259 19:8209050-8209072 CGGAGCGGGAACGGGGGCGGGGG + Intronic
1162126528 19:8502459-8502481 AGGGGCGGGCGGGGGGGCGGGGG - Intronic
1162315621 19:9936517-9936539 CGGAGCGAGCGAGGGGGCGGGGG - Exonic
1162362840 19:10230270-10230292 TGTGGCGGTCTCGGGGGCGGGGG - Intronic
1162398401 19:10430941-10430963 CGGGGCGCGCGCGGGGCCAGGGG - Intronic
1162398774 19:10432393-10432415 CGGGGCGCGCATGGGGACGGCGG - Intronic
1162412986 19:10517592-10517614 CGGGGCGCGCTCCGGTGCCGCGG - Intronic
1162481284 19:10928472-10928494 AGGGACCGGCTCGGGGGCGGGGG - Intronic
1162659834 19:12160225-12160247 CGGGGCGACTTCGGGACCGGTGG + Intergenic
1162758545 19:12874650-12874672 CGGGGAGAGCTTTGGGGAGGCGG - Exonic
1162778650 19:12995604-12995626 AGCGGCGAGCGCGGCGGCGGCGG + Exonic
1162778674 19:12995689-12995711 CGGGCCGAGCGCGGGGCCGCGGG + Exonic
1162959492 19:14117617-14117639 CGGAGCGCGCTGGGCGGCGGCGG + Exonic
1163427233 19:17246146-17246168 CTGGGCGAGGGCGAGGGCGGGGG - Intronic
1163607280 19:18281995-18282017 CCGGGCGGGGGCGGGGGCGGGGG + Intergenic
1163681283 19:18683932-18683954 CGGGGCGCGCGCGGCGGGGGCGG + Intronic
1163804130 19:19385939-19385961 CGGGGCGCGCTCGGGCGGCGGGG - Exonic
1164274220 19:23702651-23702673 AGGGGCGGGGGCGGGGGCGGGGG - Intergenic
1164594767 19:29525860-29525882 GGGGGAGCGCTCTGGGGCGGGGG + Intergenic
1164648140 19:29873752-29873774 CGGCGCGGGCGCGGGGGCGCGGG - Intergenic
1165420071 19:35718091-35718113 CGGGGCGCCGGCGGGGGCGGGGG + Exonic
1165468192 19:35987410-35987432 GGGGCGGAGCGCGGGGGCGGGGG - Intergenic
1166083268 19:40458302-40458324 AGGGGCGGGGCCGGGGGCGGGGG + Intronic
1166306850 19:41940240-41940262 CGCGGGGAGCCCGGGGGCGGAGG + Intergenic
1166361270 19:42253929-42253951 CGGGGCGGGGACGGGGGAGGGGG - Intronic
1166361318 19:42254029-42254051 CCGCGCGAGCCCGGGGGCGGCGG + Intronic
1166529732 19:43535118-43535140 CGGTGCGGGCGCTGGGGCGGGGG - Exonic
1166689363 19:44813415-44813437 CTGGGAGAGATCGGGGGAGGTGG - Intronic
1167196728 19:48034182-48034204 CGGGGCGTGGTGGGGAGCGGGGG - Intronic
1167384942 19:49157727-49157749 CGGGGCGAGGTCTGGGGGGCGGG - Exonic
1167466136 19:49651888-49651910 CGGGGCGGGCGCGGGCGCCGGGG - Exonic
1167505274 19:49867831-49867853 AGGGGCGCTGTCGGGGGCGGAGG - Intronic
1167792073 19:51689237-51689259 CTGGGCCAGCTCCGGGGCAGGGG + Intergenic
1167862493 19:52297056-52297078 GGGGGCGGGGGCGGGGGCGGGGG - Intergenic
1167862497 19:52297062-52297084 GGGGGCGGGGGCGGGGGCGGGGG - Intergenic
1167862501 19:52297068-52297090 GGGGGCGGGGGCGGGGGCGGGGG - Intergenic
1167862505 19:52297074-52297096 GGGGGCGGGGGCGGGGGCGGGGG - Intergenic
1167862509 19:52297080-52297102 GGGGGCGGGGGCGGGGGCGGGGG - Intergenic
1167862513 19:52297086-52297108 GGGGGCGGGGGCGGGGGCGGGGG - Intergenic
1167862517 19:52297092-52297114 GGGGGCGGGGGCGGGGGCGGGGG - Intergenic
1167862521 19:52297098-52297120 GGGGGCGGGGGCGGGGGCGGGGG - Intergenic
1167862525 19:52297104-52297126 GGGGGCGGGGGCGGGGGCGGGGG - Intergenic
1167862529 19:52297110-52297132 GGGGGCGGGGGCGGGGGCGGGGG - Intergenic
1167862533 19:52297116-52297138 GGGGGCGGGGGCGGGGGCGGGGG - Intergenic
1167862537 19:52297122-52297144 CGGGGCGGGGGCGGGGGCGGGGG - Intergenic
1168536084 19:57172035-57172057 CGGGGCGTGCGAGGGGGCGGGGG + Intergenic
1168536092 19:57172053-57172075 GGGGGCGTGCGAGGGGGCGGGGG + Intergenic
1168710481 19:58497277-58497299 CGGGGAGAGTCCAGGGGCGGTGG + Intronic
925343181 2:3150858-3150880 GGGTGTGTGCTCGGGGGCGGAGG - Intergenic
925609889 2:5693618-5693640 CGGCGCGACCTCGGGCGCCGGGG + Exonic
926267990 2:11344083-11344105 CGGCGCGGTCTCGGGGGCGCCGG + Exonic
926282884 2:11464930-11464952 CGGGGAGAGGTCGGGCTCGGTGG + Intronic
926661278 2:15469825-15469847 CGGGGCCTGCTGGGGGGTGGGGG + Intronic
927194570 2:20538764-20538786 CGGGCCCAGCTCAGGGGCAGAGG - Intergenic
927596633 2:24403171-24403193 GGGGGCGAGCGCGGGGGGCGGGG - Intergenic
927637417 2:24826220-24826242 CGGGGTGAGCTCTAGGGCTGGGG - Intronic
927679258 2:25129320-25129342 GGGGGCGGGGGCGGGGGCGGGGG + Intronic
927679262 2:25129326-25129348 GGGGGCGGGGGCGGGGGCGGGGG + Intronic
927708269 2:25310399-25310421 CAGGCCGAGCTCTGGGGCTGTGG - Intronic
927714281 2:25342105-25342127 CGGGGCCAGCGCGGCCGCGGGGG - Intronic
927966883 2:27275867-27275889 GGGGGCGGGGGCGGGGGCGGGGG - Intronic
927966887 2:27275873-27275895 GGGGGCGGGGGCGGGGGCGGGGG - Intronic
927988346 2:27429040-27429062 GGGGGCGGGGGCGGGGGCGGCGG + Intronic
928088100 2:28358304-28358326 TGGGGCGGGGTCGGGGTCGGCGG - Intergenic
928421145 2:31138488-31138510 CGGGAGGAGCACGAGGGCGGAGG + Intronic
929189314 2:39124487-39124509 GGCGGCGAGGACGGGGGCGGGGG + Intergenic
929303442 2:40332421-40332443 TGGGGGGAGGACGGGGGCGGGGG + Intronic
929452750 2:42047956-42047978 GGGGGCGGGGGCGGGGGCGGGGG + Intergenic
930358228 2:50346894-50346916 CTGGGCTCGCCCGGGGGCGGCGG - Intronic
931241873 2:60461302-60461324 CGGGGCGCGGTCGTGGGCGTGGG - Exonic
931253853 2:60554151-60554173 GGGAGCGAGCGCGGCGGCGGCGG - Intergenic
931649385 2:64454455-64454477 CGGGGCGGGGGCGGGGGCGCGGG - Exonic
932292690 2:70595720-70595742 CGGGGCCTGTTCGGGGGTGGTGG + Intergenic
932625670 2:73293738-73293760 CGGCGCGAGCCTGGCGGCGGCGG - Intergenic
934501967 2:94869210-94869232 AGGGGCGTGCTCAGGGGCGGAGG - Intergenic
935201018 2:100856707-100856729 CGGGGTGGGGGCGGGGGCGGGGG + Intronic
936122682 2:109760392-109760414 CGGGGCGGGGGCGGCGGCGGCGG + Intergenic
936222011 2:110611081-110611103 CGGGGCGGGGGCGGCGGCGGCGG - Intergenic
936985858 2:118310900-118310922 CGGGGCGAGCTCGACGGCCCGGG - Intergenic
937110941 2:119366854-119366876 CGGGGCTAGCGCCGCGGCGGGGG + Intergenic
937282649 2:120730875-120730897 CGGGGTGGGCACGGGGGGGGGGG + Intergenic
937933057 2:127220197-127220219 CGGGGTGGGCTCCTGGGCGGCGG - Intergenic
937950870 2:127387497-127387519 AGGGGCGGGCTCGGCGGGGGCGG - Intronic
938607457 2:132910394-132910416 GGGGGCGTGCTCGGGGGAGATGG - Intronic
941987475 2:171522950-171522972 CGCCGCGAGCGCGGGGCCGGGGG + Intronic
942045860 2:172099120-172099142 CTAGGCGGGCGCGGGGGCGGTGG + Intergenic
942136500 2:172931178-172931200 GGGGGGGCGCTGGGGGGCGGGGG + Intronic
942453309 2:176121980-176122002 AGGGGCGAGCCGGGGCGCGGCGG - Intergenic
942453524 2:176122941-176122963 CGAGGCGAACTCGGCGGCGGTGG - Exonic
942890346 2:180980583-180980605 CGAGGCGAGCGCGGGGGGGAGGG - Intronic
945241552 2:207681458-207681480 CGCGGCGAGGGCGGCGGCGGGGG - Intergenic
946692387 2:222319429-222319451 CGGGGCGGGCTCGAGGCCCGGGG + Intergenic
947625137 2:231614243-231614265 CGAGGCGCGCTCCGGGGCGGGGG + Intergenic
947641259 2:231708971-231708993 CCGGGCGCCCTCGGGGGCCGAGG + Intronic
948046858 2:234951945-234951967 GGGGGCGGGGGCGGGGGCGGGGG - Intergenic
948046862 2:234951951-234951973 GGGGGCGGGGGCGGGGGCGGGGG - Intronic
948046866 2:234951957-234951979 CTGGGCGGGGGCGGGGGCGGGGG - Intronic
948179494 2:235968510-235968532 CGGGTCGAGCTTGGGGCTGGTGG - Exonic
948801432 2:240435333-240435355 GGGGGCGGGGACGGGGGCGGAGG - Intergenic
948824856 2:240569122-240569144 CGGGGCGGGCGCCGGGGCTGCGG + Intronic
948893052 2:240916379-240916401 GGGGGCGAGCAGGGGGGCGCAGG - Intergenic
1168882867 20:1223143-1223165 CGGGGCCTGCTGGGGGGTGGGGG + Intergenic
1170163958 20:13343577-13343599 GGGGGCGGGGGCGGGGGCGGCGG - Intergenic
1170612133 20:17923365-17923387 GGGGGCGGGGGCGGGGGCGGGGG - Intergenic
1171012432 20:21515809-21515831 CGGGGGCAGCTGGGGCGCGGCGG - Intergenic
1171473643 20:25390914-25390936 CGGGGCGGGGCCGGGGGAGGGGG - Exonic
1171489773 20:25508658-25508680 CAGGGGGAGCTGGGGGGCGCTGG + Intronic
1172037014 20:32018191-32018213 AGGGGCGGGGGCGGGGGCGGGGG + Intronic
1172101213 20:32484569-32484591 GGGGGCGGGCACGCGGGCGGCGG - Intronic
1172295928 20:33811315-33811337 CGGGCCCAGCTGCGGGGCGGAGG + Exonic
1173279747 20:41618009-41618031 CGGGCCGCGCGCAGGGGCGGGGG - Intronic
1174037081 20:47674922-47674944 CGGGGCTGGGTCGGGGGCCGTGG + Intronic
1174045455 20:47729725-47729747 TGGGGAGAGCTCTGGGGCGATGG + Intronic
1174133218 20:48360173-48360195 CGGGGCGGGGGCGGGGGCGGGGG + Intergenic
1174607058 20:51768514-51768536 GGGGGCGAGCTCGCGAGCGCCGG + Exonic
1175108465 20:56630229-56630251 CTAGGCGAGCTCAGGGGCGCCGG + Intronic
1175847105 20:62065001-62065023 CGGGGCGGCGGCGGGGGCGGCGG + Exonic
1175847112 20:62065016-62065038 GGCGGCGGGCGCGGGGGCGGCGG + Exonic
1175890284 20:62312895-62312917 CTGGCCGAGGTCAGGGGCGGTGG + Exonic
1175903030 20:62367397-62367419 CGGGGAGAGGTCCGGGGAGGCGG + Intergenic
1175944309 20:62551572-62551594 GGCGGCGAGGTGGGGGGCGGGGG + Intronic
1176103836 20:63376508-63376530 CGGGGGGAGCCCAGGAGCGGAGG + Intronic
1176221211 20:63970022-63970044 CGGGGAGGGGGCGGGGGCGGGGG + Intronic
1176221215 20:63970028-63970050 GGGGGCGGGGGCGGGGGCGGGGG + Intronic
1176223578 20:63981374-63981396 TGGGGCGTGTTTGGGGGCGGGGG + Intronic
1176223618 20:63981649-63981671 CGGGGCGGGCGGGCGGGCGGGGG - Intronic
1176875650 21:14124405-14124427 CGGGGCGGGGTCGGGGGAGGTGG - Intronic
1176952685 21:15065054-15065076 CGCGGCGGACTCGGCGGCGGAGG - Intergenic
1178534910 21:33403353-33403375 CGGGGCGGGGGCGGGGGCGCGGG + Exonic
1179437169 21:41369837-41369859 CGGGGCGGGAGCGGGGGCGGGGG - Intronic
1179561557 21:42219090-42219112 CGGGGCGGGGTCGGGCGCGCTGG + Intronic
1179891791 21:44339044-44339066 CGGGGCGAGGGCGGAGCCGGAGG - Intronic
1179984716 21:44913998-44914020 TGGGGCCAGCTCAGGGGCTGGGG - Intronic
1180084979 21:45504458-45504480 AGGGGGGAGCCCGGGGGCGGCGG + Exonic
1180187241 21:46145832-46145854 CGGGGGCGGCTCGGTGGCGGCGG - Exonic
1180559337 22:16602331-16602353 CGGGGCGGGCCCGCGGGCGGCGG + Intergenic
1180699682 22:17774499-17774521 CGGGGCGGGCCCGGGCGTGGGGG - Intronic
1181028492 22:20138864-20138886 TGGGGCGGGGTAGGGGGCGGGGG - Intronic
1181381504 22:22508384-22508406 CGGGCCCAGCCCGGGGGTGGGGG + Intronic
1182102295 22:27666679-27666701 CTGGGCTAGCTTGGGGGAGGAGG - Intergenic
1182576473 22:31276573-31276595 CGCGGCGAGGGCGGCGGCGGGGG - Intronic
1182586341 22:31346154-31346176 CGGGGCGCGCACGGGGGCGGTGG + Exonic
1182593415 22:31399494-31399516 CGGGGCGGGGTCGGGTGAGGGGG + Intergenic
1182941585 22:34282232-34282254 TGGGGAGAGCGGGGGGGCGGGGG - Intergenic
1183386658 22:37519137-37519159 CGGGGCCGGCTCGGGGTCTGAGG - Exonic
1183504650 22:38202396-38202418 CGAGGCCAGCTCGGGGGAGTGGG + Intronic
1183506962 22:38214748-38214770 CGTGGCGGGCCCGCGGGCGGCGG - Exonic
1184236753 22:43187144-43187166 CGGGGCGGGGCAGGGGGCGGAGG - Intergenic
1184265283 22:43343072-43343094 CGGGGCGAGCTCGGGATCCGCGG + Intronic
1184411406 22:44328553-44328575 TGGGGCGGGTTGGGGGGCGGTGG - Intergenic
1184439219 22:44498304-44498326 CGGGGCCGGCGCGGTGGCGGTGG + Intergenic
1184472125 22:44702130-44702152 CGGGGCGGGGAAGGGGGCGGGGG - Intronic
1184523157 22:45007602-45007624 TGTGGCGGGCACGGGGGCGGCGG - Intronic
1184562115 22:45269270-45269292 GGGGGCGGGGGCGGGGGCGGGGG + Intergenic
1184562119 22:45269276-45269298 GGGGGCGGGGGCGGGGGCGGGGG + Intergenic
1184562123 22:45269282-45269304 GGGGGCGGGGGCGGGGGCGGGGG + Intergenic
1185071933 22:48661388-48661410 CGGGGCGAGTTCTGCGGCCGGGG - Intronic
1185272725 22:49936181-49936203 CGGCCCGAGCTCTGGGGCGTGGG + Intergenic
949351245 3:3126860-3126882 CGGGGCGAGGGCGAGTGCGGGGG - Intergenic
950345285 3:12287787-12287809 GGGGGCGGGGGCGGGGGCGGCGG - Intronic
950345287 3:12287793-12287815 GGGGGCGGGGGCGGGGGCGGGGG - Intronic
950345291 3:12287799-12287821 GGGGGCGGGGGCGGGGGCGGGGG - Intronic
950644168 3:14367292-14367314 TGAGGGGAGCTGGGGGGCGGGGG + Intergenic
950710559 3:14810597-14810619 GGGCGCGAGCGCGGGGGCGGCGG - Intergenic
951981872 3:28575565-28575587 CAGGGCCAGCGCGGAGGCGGGGG + Intergenic
952451870 3:33440404-33440426 CGGGGCGGGGCCGGGGGAGGCGG - Intronic
953399563 3:42600929-42600951 AGGGGCGAGGGCGGGGGCGAGGG - Intronic
953931935 3:47009887-47009909 CGGGGCGAGATGTGGGGCAGGGG - Intergenic
954152011 3:48662522-48662544 CAGGAGGAGCTGGGGGGCGGTGG - Exonic
954305704 3:49724216-49724238 CGGGGCGAGGCCGGGGCCGTGGG - Intergenic
954539766 3:51385525-51385547 GAGGGCGAGGGCGGGGGCGGGGG + Intronic
954632763 3:52056222-52056244 CGGGGCGGGCGCGGCGACGGGGG - Exonic
954912583 3:54122067-54122089 CCGGGCGGGGTCGGGGGCCGCGG - Intergenic
955356594 3:58237472-58237494 CGGGGCGGGGGCGGGGGCGGGGG + Intergenic
955356598 3:58237478-58237500 GGGGGCGGGGGCGGGGGCGGGGG + Intergenic
960914369 3:122681194-122681216 CGGGGCGGGGGCGGGGGCGGGGG + Intronic
961003049 3:123386775-123386797 CGGGGTGGGGTCGGGGGCGCTGG - Intronic
961186246 3:124917743-124917765 TGGGGCGGGGGCGGGGGCGGGGG + Intronic
961446215 3:126982999-126983021 CGGGGCGGGGGCGGGGCCGGCGG - Intergenic
961446306 3:126983265-126983287 CGGGGCGCGCCCCGGGGCGGCGG + Intergenic
961458972 3:127038312-127038334 AGGTGGGAGCTTGGGGGCGGTGG - Intergenic
961574452 3:127823217-127823239 CTGGGCCGGCTCGGCGGCGGGGG + Intronic
961612606 3:128152962-128152984 CGGGGGGAAGACGGGGGCGGGGG - Intronic
962272335 3:133987132-133987154 CGGGGCGGGGGCGGGGGGGGGGG - Intronic
964118562 3:153160722-153160744 CAGGCTGAGCTCGGCGGCGGCGG - Intergenic
964819575 3:160755510-160755532 CGGGGCGAGCGCGCGGGGGGCGG + Intergenic
966390867 3:179451320-179451342 GGCGGCGAGCTCGCGAGCGGCGG - Intronic
966712026 3:182980713-182980735 CGGGGAGTGGGCGGGGGCGGGGG + Intronic
966866534 3:184261497-184261519 CCGGGCGGGGGCGGGGGCGGGGG + Intronic
967055240 3:185824743-185824765 CGGGGCGAGGCGGGGGGAGGGGG + Intronic
967732327 3:192917884-192917906 GGGGGCGGGGTGGGGGGCGGGGG - Exonic
967866498 3:194194345-194194367 CTGGGGGAGCACGGGGGCAGTGG - Intergenic
968123127 3:196140417-196140439 CGGGCAGAGGTGGGGGGCGGGGG - Intergenic
968148283 3:196317995-196318017 CGGGGCGACCTCGAGCGCGCTGG - Intronic
968479301 4:826436-826458 GGGGGCGGGGGCGGGGGCGGGGG + Intergenic
968518347 4:1024129-1024151 CGGGGGGTGCTGGTGGGCGGGGG + Intronic
968548169 4:1209168-1209190 CGGGCTGTGCTCGCGGGCGGCGG - Intergenic
968571930 4:1346658-1346680 CGGGGCGAGCTCGGGGGCGGGGG + Intergenic
968659406 4:1793049-1793071 CGGGGCGGCCCAGGGGGCGGCGG - Intergenic
968729187 4:2261695-2261717 CCGGGCGGGGTCGGGAGCGGGGG + Intronic
968997961 4:3956861-3956883 CGGGGTGGGCTTGGGGGTGGTGG + Intergenic
969436633 4:7192719-7192741 CGCGGCGAGCGCGGCGGCGGCGG - Exonic
969669156 4:8580306-8580328 CGGGGCGGGGAAGGGGGCGGGGG - Intronic
969714286 4:8860961-8860983 GGGGGCGAGGGCGGGGGAGGGGG + Intronic
969873185 4:10117002-10117024 CGGGGCGAGCAAGGCGGAGGCGG - Intergenic
972770981 4:42196863-42196885 GGGGGCGGGGGCGGGGGCGGGGG - Intergenic
972770985 4:42196869-42196891 AGGGGCGGGGGCGGGGGCGGGGG - Intergenic
973551284 4:52038270-52038292 GGCGGGGAGCTCGGCGGCGGCGG - Exonic
974742564 4:66025050-66025072 CGGGGCCAGTTCGGGGGTGCGGG + Intergenic
975701915 4:77075446-77075468 AGGGGCGGGGGCGGGGGCGGGGG - Intronic
977908281 4:102501639-102501661 CGGGGCGAGCGGGAGCGCGGCGG - Exonic
979785676 4:124712789-124712811 CGGGGCGGGGGCGGGGGCGGGGG - Intergenic
981128619 4:141133398-141133420 CGGGGCGGGCTTGGGGACAGTGG + Intronic
982042400 4:151409120-151409142 GGGGGCGGGGGCGGGGGCGGGGG - Intergenic
983249281 4:165326889-165326911 GGGGGCGGGGGCGGGGGCGGGGG - Intergenic
983792240 4:171813056-171813078 CGCGGCGAGCCGGGGCGCGGCGG - Intronic
983919809 4:173333826-173333848 CGGGGCGCGGGCGGGGGCGCGGG - Intronic
984778399 4:183504240-183504262 CCAGGCGAGCTCGGAGGCGGCGG + Intergenic
985472379 5:53929-53951 AGGGGCGGGCCCGGGGGCCGGGG + Intergenic
985784564 5:1887028-1887050 CGGGGCGGGGGCGGGAGCGGGGG + Exonic
986184398 5:5422624-5422646 CGGGGCGAGCCAGGGCGGGGCGG + Intronic
986184407 5:5422644-5422666 CGGGGCGAGCCAGGGCGGGGCGG + Intronic
986330521 5:6713658-6713680 CGGGGCGGGCGCGGGGGCCGCGG - Intergenic
986330847 5:6714709-6714731 CGGGGAGGCCGCGGGGGCGGGGG + Intronic
986748098 5:10761387-10761409 GGGGGCGGGGGCGGGGGCGGGGG + Intergenic
986748102 5:10761393-10761415 GGGGGCGGGGGCGGGGGCGGGGG + Intergenic
986748104 5:10761399-10761421 GGGGGCGGGGGCGGGGGCGGAGG + Intergenic
989408060 5:41083698-41083720 CGGGGTGGGGTGGGGGGCGGGGG + Intergenic
990545386 5:56816182-56816204 CGGGGGGTGCTCAGGGGCGTAGG - Intronic
991587736 5:68216445-68216467 CGGGGCGGGCGAGGCGGCGGTGG + Intronic
992939652 5:81750491-81750513 CGCGGGGAGCGCGGCGGCGGGGG - Intronic
993457373 5:88141743-88141765 GGGGGCGGGGGCGGGGGCGGAGG - Intergenic
994083293 5:95731470-95731492 CAGGGCGGGCTAGCGGGCGGGGG - Exonic
996900590 5:128538289-128538311 CGGGGCGGGCCGGCGGGCGGCGG + Intronic
997262078 5:132473106-132473128 CGGTGTGAGCTGCGGGGCGGTGG + Intronic
997292503 5:132747776-132747798 CGGAGCTTGCTCTGGGGCGGCGG - Exonic
999328264 5:150656740-150656762 GGGGGCGGGGGCGGGGGCGGTGG - Intronic
999328266 5:150656746-150656768 GGGGGCGGGGGCGGGGGCGGGGG - Intronic
999328270 5:150656752-150656774 GGGGGCGGGGGCGGGGGCGGGGG - Intronic
1001065055 5:168529538-168529560 GGGGGCGGCCGCGGGGGCGGCGG + Exonic
1001488384 5:172136978-172137000 CGGGGCCTGTTCGGGGGTGGGGG - Intronic
1001831298 5:174791378-174791400 TGGGGTGGGCCCGGGGGCGGGGG + Intergenic
1002140336 5:177133912-177133934 CCGGGCCAGCTGGGGGGAGGGGG - Exonic
1002175185 5:177397629-177397651 CGGGGTGATCTCGGGGCAGGGGG + Intronic
1002512645 5:179732968-179732990 CGGAGCGGGCTCGCGCGCGGCGG - Exonic
1002710532 5:181192207-181192229 TGGGGCGAGCTGGGCGGTGGGGG + Intergenic
1002714329 5:181217092-181217114 GGGGGCGGGGGCGGGGGCGGAGG + Intergenic
1002927280 6:1611682-1611704 CAGGGCGCGCCCGGGGGCGCGGG + Exonic
1002927343 6:1611897-1611919 CTTGGCGAGCGCGGCGGCGGCGG + Exonic
1002929026 6:1620703-1620725 CTGGGCGGGCTCGGGGCCCGAGG + Intergenic
1003291276 6:4780407-4780429 CGGGGCGGGGGCGGGGGCGGGGG - Intronic
1004044726 6:12012570-12012592 CGGCGCGGGCTCCGCGGCGGGGG + Intronic
1004615050 6:17281447-17281469 AAGGGCGAGCCCGGGGGCGAGGG - Exonic
1004627915 6:17393906-17393928 CGGCGCGGGCGCGGGGGCCGGGG + Intronic
1005760153 6:28960636-28960658 GGGTGTGTGCTCGGGGGCGGAGG - Intergenic
1005826267 6:29633118-29633140 CAGGGAGAGCTCCCGGGCGGAGG + Exonic
1006933124 6:37699151-37699173 CGGGGCGGGATCGGAGGCGCGGG - Intronic
1007378209 6:41470525-41470547 CTGGGCCAGCGCGGGGGCCGGGG + Intergenic
1007451313 6:41941776-41941798 CGGCGCGCGCGCGCGGGCGGCGG - Exonic
1007521392 6:42453367-42453389 CGCGGCGCGGGCGGGGGCGGAGG + Intergenic
1007573771 6:42911627-42911649 GGCGGCTGGCTCGGGGGCGGGGG + Intergenic
1007927676 6:45663346-45663368 CGGGGCGGCCTCCGGGGAGGAGG - Intronic
1008013250 6:46491014-46491036 GGGGGCGGGGGCGGGGGCGGTGG - Intronic
1008013252 6:46491020-46491042 GGGGGCGGGGGCGGGGGCGGGGG - Intronic
1008013256 6:46491026-46491048 CAGGGCGGGGGCGGGGGCGGGGG - Intronic
1008629127 6:53347719-53347741 GGTGGCGGGGTCGGGGGCGGGGG - Intronic
1010244787 6:73653499-73653521 GGGGGCGGGGGCGGGGGCGGGGG - Intronic
1010244791 6:73653505-73653527 GGGGGCGGGGGCGGGGGCGGGGG - Intronic
1010244795 6:73653511-73653533 CCGGGCGGGGGCGGGGGCGGGGG - Intronic
1010815794 6:80356935-80356957 GGGGGCGGGGGCGGGGGCGGGGG - Intergenic
1011226610 6:85114973-85114995 TGGGGCGGGGGCGGGGGCGGGGG + Intergenic
1015625937 6:135181192-135181214 CAGGGCGACCGCGGAGGCGGCGG + Intergenic
1016340900 6:143060787-143060809 CGGGGCGGGGGCGGGGGCGGGGG - Intronic
1016461804 6:144286049-144286071 CGTGGAGAGCTCGGGCGTGGAGG + Intronic
1018824059 6:167396321-167396343 GGGGGCGAGCCCGGAGGCCGTGG - Intergenic
1019179029 6:170175802-170175824 AGGGGCGGGGGCGGGGGCGGGGG - Intergenic
1019343585 7:519520-519542 GGAGGCGAGCGCGGGGCCGGCGG - Intronic
1019343703 7:519897-519919 GGGGGCGGGGGCGGGGGCGGGGG - Intronic
1019449849 7:1091805-1091827 CAGGTTGAGCTCGGGGGAGGTGG - Exonic
1019828119 7:3300924-3300946 CGTGGCGGGCTCGCGGGCGGGGG - Intergenic
1020011545 7:4808217-4808239 CGGGGAGAGAGAGGGGGCGGAGG - Intronic
1020092948 7:5351486-5351508 TGGGGGGAACTCGGGGGAGGGGG + Intronic
1021217840 7:17939851-17939873 CTGACCGAGCTCGGAGGCGGAGG + Intronic
1021795435 7:24249569-24249591 AGGGGCTAGGTCGGGCGCGGTGG + Intergenic
1022207967 7:28180813-28180835 CGGGGGGAGGGCGGGGGCGGGGG + Intergenic
1022715149 7:32891885-32891907 GGGGGCGGGGGCGGGGGCGGCGG - Exonic
1022715151 7:32891891-32891913 CGCGGCGGGGGCGGGGGCGGGGG - Exonic
1022739742 7:33109501-33109523 CGGGGTGAGTTGCGGGGCGGCGG - Intergenic
1023638793 7:42237908-42237930 CGGGCCGGGGTCGGGGGCTGGGG + Intergenic
1023881936 7:44325665-44325687 CGGGGCGGGCGCGGCGGCGGCGG - Intronic
1023972286 7:45000229-45000251 CGCCGGGAGCGCGGGGGCGGCGG + Intronic
1025028113 7:55534823-55534845 TGGGGTGAGCTAGTGGGCGGTGG - Intronic
1025917038 7:65873701-65873723 CGGGGCCAGGCGGGGGGCGGCGG + Intronic
1026236955 7:68535160-68535182 CGGGGGGAGGTGGTGGGCGGGGG + Intergenic
1026360583 7:69598529-69598551 CGGGGCTTTCTCGGCGGCGGCGG + Intergenic
1027138290 7:75639439-75639461 CCGTGCGAGCCCGGGGGCCGCGG - Intronic
1028160102 7:87475719-87475741 GGGGGCGGGGGCGGGGGCGGGGG - Exonic
1029238697 7:99143674-99143696 CGGGGCGGGCGAGGGGGCGCCGG + Intronic
1029238730 7:99143816-99143838 CGGGCCGGGCTGGGGGGCGGTGG - Exonic
1030022930 7:105293490-105293512 CGGGGCGGGGTGGGGGGTGGAGG - Intronic
1030600155 7:111583398-111583420 GGGGGCGGGGTGGGGGGCGGGGG + Intergenic
1031361830 7:120857371-120857393 CGGGGCGGGGGCGGGGGCGGGGG + Intronic
1031485343 7:122317063-122317085 GGGTCCGAGCTCGGGGGCGCGGG + Intergenic
1031982307 7:128135850-128135872 GCGCGCGAGCTCGGCGGCGGCGG + Intergenic
1032020721 7:128405984-128406006 CGGGCCGGGGGCGGGGGCGGGGG + Intronic
1032020831 7:128406314-128406336 GGGGGAGAACTCGGGGGTGGGGG - Intronic
1032274240 7:130440764-130440786 CGGGCCGGGCTTGGGGGCCGCGG - Intronic
1032298796 7:130668390-130668412 CGGGGCGCGCGCGGGCGCCGGGG + Intronic
1032391252 7:131556669-131556691 AGGGGCGGGGGCGGGGGCGGGGG - Intronic
1034617906 7:152435488-152435510 CGGGGCGGGCCCGCGGGCGGTGG - Intronic
1034869953 7:154675195-154675217 CGGGGCCTGTCCGGGGGCGGGGG + Intronic
1035167414 7:156999983-157000005 GGGGGCGGGCCCGGGGCCGGGGG + Intronic
1035476077 7:159144988-159145010 CGGGGCGGGGACAGGGGCGGGGG - Intergenic
1035580936 8:738621-738643 CGCGGAGGGCTGGGGGGCGGCGG + Intergenic
1035787730 8:2275604-2275626 TGGGGCGAGGCCGGGGGCTGAGG - Intergenic
1035805081 8:2446112-2446134 TGGGGCGAGGCCGGGGGCTGAGG + Intergenic
1037897657 8:22668918-22668940 CGGGCCTTGCTCTGGGGCGGAGG + Intronic
1038101427 8:24381305-24381327 CGGGGCCTGCTGGGGGGTGGGGG - Intergenic
1039864593 8:41490317-41490339 CGGGGCGAGCTGTGGGGCTGCGG - Intergenic
1039864601 8:41490341-41490363 CGGGGCGAGCTGTGGGGCTGCGG - Intergenic
1041355380 8:56993909-56993931 CGGGGCGAGGGCGAGGGCGAGGG + Intergenic
1041690374 8:60680362-60680384 CGGGGCGGGCGCGGCGGCGCGGG + Intronic
1042116099 8:65433169-65433191 CGGGGCCTGCTGGGGGGTGGGGG - Intergenic
1046659889 8:116938152-116938174 CGGGGTCAGGGCGGGGGCGGAGG - Intergenic
1048472151 8:134713100-134713122 CGGGCCGCGCTCGGCGCCGGGGG - Intergenic
1049145838 8:141000853-141000875 GGGGGCGCGCTGGGAGGCGGGGG - Intronic
1049212175 8:141391896-141391918 AGGGGCGGCCTCGGGGGCGGCGG + Intergenic
1049659930 8:143815408-143815430 CTCGGCGGGCTCGGGGCCGGGGG + Intergenic
1049784498 8:144444110-144444132 CGGGCCGGGATCGGGGGCCGGGG - Intronic
1052539799 9:29795834-29795856 CGGGGCCTGCTGGGGGGTGGGGG - Intergenic
1053000337 9:34574224-34574246 AGGGGCCAGCTCGTGGGCTGGGG + Intronic
1053163562 9:35829499-35829521 CGGGGCGAGGGCGGGGCTGGGGG - Exonic
1056154153 9:83817837-83817859 CGGGGCGGGGGCGGGGGCGGGGG + Intronic
1056925137 9:90828230-90828252 CGGGGCGGGGGGGGGGGCGGGGG - Intronic
1057208133 9:93185207-93185229 CGCTGCGGGCGCGGGGGCGGCGG - Exonic
1057596413 9:96418748-96418770 CGGGGCGGGGTCGGGGGGGGTGG + Intergenic
1058005149 9:99906588-99906610 CGGGGCGGGGGCGGGGGCGGGGG + Intergenic
1058439084 9:104991216-104991238 CGGGGCCGGCGCTGGGGCGGGGG - Intergenic
1058650437 9:107170824-107170846 CGGGGGGTGGTGGGGGGCGGGGG + Intergenic
1059375405 9:113876650-113876672 CGGTCCGAGCCCGGGGCCGGAGG - Intronic
1060114422 9:120929049-120929071 CGGGGCGAGGAAGGGGGCCGGGG + Intronic
1060209038 9:121699268-121699290 CGGGGTTAGCGCGGCGGCGGCGG - Intronic
1060477941 9:123999673-123999695 GGGGGCGGGGGCGGGGGCGGCGG - Intergenic
1060888833 9:127175540-127175562 CAGGGAGAGGTCGGGGGCGTGGG + Intronic
1060994601 9:127868931-127868953 CGGGGAGTACTGGGGGGCGGGGG - Intronic
1061289271 9:129641666-129641688 CGGGGAGGGCCCGAGGGCGGAGG - Intronic
1061348227 9:130043303-130043325 CCGGGGGAGCCCGGGGGAGGGGG - Intergenic
1061366021 9:130172775-130172797 GGGGGCGGGGGCGGGGGCGGTGG - Intronic
1061540780 9:131277100-131277122 CGGGGCGGGCGCGGGGGGCGGGG - Intergenic
1061608945 9:131733354-131733376 CGGGGCGGGGGCGGGGGGGGGGG + Intronic
1061857327 9:133449447-133449469 CGGGGTGGGCTCCAGGGCGGTGG + Intronic
1062036430 9:134384616-134384638 CAGGGCGTGCTGGGGGGCAGGGG + Intronic
1062162467 9:135087823-135087845 CGGGGCGCGCGGGGCGGCGGCGG + Exonic
1062348792 9:136128656-136128678 AGGGAGGAGCTCGGGGGCTGAGG + Intergenic
1062349745 9:136133054-136133076 CGGGGCAGGCTCTGGGGCGCGGG - Intergenic
1062349790 9:136133151-136133173 CGGGGCAAGCTTAGGGGCAGGGG - Intergenic
1062391022 9:136333899-136333921 CTGGGAGAGCTTGGGGGTGGGGG + Intronic
1062414689 9:136442350-136442372 AGGGGCCAGCTTGGGGGCAGTGG + Intronic
1062421037 9:136482911-136482933 GGGGGCGAGCGCGGGTGAGGGGG - Intronic
1062531156 9:137001025-137001047 CGGCGAGACCTCGGGGGCGGCGG + Intergenic
1062531164 9:137001042-137001064 CGGCGGGACCTCGGGGGCGGCGG + Intergenic
1062532845 9:137009319-137009341 TGGGGCGGGCCCGGGGGGGGCGG - Intronic
1062556094 9:137114091-137114113 CCGGGCGGGGTCGCGGGCGGGGG - Intronic
1062556111 9:137114132-137114154 CCGGGCGGGGTCGCGGGCGGGGG - Intronic
1062556128 9:137114173-137114195 CCGGGCGGGGTCGCGGGCGGGGG - Intronic
1062579246 9:137222228-137222250 CGTGGCGCGCTCTGCGGCGGAGG + Intergenic
1185621490 X:1453417-1453439 CGGGGCGAGCGCCGGGGGCGGGG - Intronic
1185736585 X:2500747-2500769 GCGGGCTGGCTCGGGGGCGGGGG - Intronic
1185747456 X:2584163-2584185 CGGGGCGCGCGGGAGGGCGGGGG + Intergenic
1185747463 X:2584180-2584202 CGGGGGGCGCGCGGGGGCGCGGG + Intergenic
1186466124 X:9786024-9786046 GCGGGCGAGGACGGGGGCGGAGG - Intronic
1187163903 X:16787134-16787156 CGGGGAGCGCAGGGGGGCGGGGG - Intronic
1187226073 X:17376078-17376100 CGAGGCGTCCTCGGCGGCGGCGG + Exonic
1188004387 X:25007204-25007226 CTGGCCGAGCCCGGAGGCGGAGG + Exonic
1188881847 X:35499534-35499556 CGGGGGGAGCGCGGGGGGGGGGG - Intergenic
1189001999 X:36957671-36957693 CGGAGCGGGCGCGGGGCCGGCGG + Intergenic
1189280611 X:39818154-39818176 CGGGGCGAGCCAGGAGACGGGGG - Intergenic
1189310622 X:40014923-40014945 GGGGGCGGGGGCGGGGGCGGAGG - Intergenic
1189310624 X:40014929-40014951 CGGGGCGGGGGCGGGGGCGGGGG - Intergenic
1189323015 X:40097544-40097566 CGGGGCGGGCTCGGGGCCTCCGG + Intronic
1189323094 X:40097878-40097900 CGGGCCGAGCTCGGCGGCTGCGG - Intronic
1190059201 X:47200070-47200092 CGGGGCCAGGCCGGGTGCGGTGG - Intronic
1190298658 X:49043299-49043321 GGTGGCGAGCTGGGGGGAGGGGG - Exonic
1192251423 X:69417016-69417038 CGGGGGGTGCTGGGGGGCGGGGG - Intergenic
1192467361 X:71366694-71366716 CGAGGCGAGCCCGGGGCCAGGGG + Intronic
1193679614 X:84502243-84502265 TGGGGCGAGGTTGGGGGTGGGGG - Intronic
1195136818 X:101916228-101916250 CGGGGCCAGTTGGGGGGTGGGGG + Intronic
1195239272 X:102935037-102935059 GGGGGCGGGGGCGGGGGCGGGGG + Intergenic
1196645875 X:118116868-118116890 GGGGGGGAGCGCGCGGGCGGGGG + Intronic
1197195910 X:123700502-123700524 CGGGGCGGGGCTGGGGGCGGCGG + Intronic
1197873547 X:131082386-131082408 CGGTGCGGGCGCGGGGGCGGCGG + Intronic
1197981102 X:132218237-132218259 CGGGGCGAGCCGGGTGGCGCTGG + Intronic
1198488073 X:137108270-137108292 CGGGGCGAGTTGGGGGCTGGGGG + Intergenic
1198518552 X:137430461-137430483 CGGGGCGGGGGAGGGGGCGGGGG + Intergenic
1199757072 X:150874560-150874582 GGGGGCGGGGGCGGGGGCGGGGG + Intronic
1199772823 X:150984694-150984716 CGGGGCGGGACCGGGAGCGGGGG - Intronic
1199832988 X:151562872-151562894 CGGGGGGGGCGGGGGGGCGGGGG + Intergenic
1199984609 X:152941718-152941740 CGGGACGAGCTCGGCCTCGGCGG + Intronic
1199997166 X:153032768-153032790 CGGGGCGAGTTCGGCCTCGGCGG + Intergenic
1200058745 X:153474707-153474729 GGGGGCGGGGGCGGGGGCGGGGG + Intronic
1200058749 X:153474713-153474735 GGGGGCGGGGGCGGGGGCGGGGG + Intronic
1200092952 X:153644284-153644306 GGGGGCGGGTGCGGGGGCGGGGG + Intronic
1200128464 X:153829204-153829226 CGGGGCGGGGGCGGGGGCGGGGG - Intronic
1200128473 X:153829216-153829238 CGGCGAGAACTCCGGGGCGGGGG - Intronic
1200142870 X:153910473-153910495 CGGGGCGAGTGCTGGGGTGGGGG - Intronic
1200224761 X:154411452-154411474 CGAGGCCAGCCCCGGGGCGGCGG - Intronic