ID: 968574929

View in Genome Browser
Species Human (GRCh38)
Location 4:1361207-1361229
Sequence GGACCACAGCACCACAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 867
Summary {0: 1, 1: 0, 2: 8, 3: 48, 4: 810}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968574929_968574939 8 Left 968574929 4:1361207-1361229 CCAGGCCTGTGGTGCTGTGGTCC 0: 1
1: 0
2: 8
3: 48
4: 810
Right 968574939 4:1361238-1361260 GCAGCTGGGACTCCAGGAAGCGG 0: 1
1: 0
2: 10
3: 113
4: 1558
968574929_968574933 -6 Left 968574929 4:1361207-1361229 CCAGGCCTGTGGTGCTGTGGTCC 0: 1
1: 0
2: 8
3: 48
4: 810
Right 968574933 4:1361224-1361246 TGGTCCTGGCCCCTGCAGCTGGG 0: 1
1: 1
2: 1
3: 23
4: 331
968574929_968574942 28 Left 968574929 4:1361207-1361229 CCAGGCCTGTGGTGCTGTGGTCC 0: 1
1: 0
2: 8
3: 48
4: 810
Right 968574942 4:1361258-1361280 CGGCCCGAGGCCCACCATGCTGG No data
968574929_968574932 -7 Left 968574929 4:1361207-1361229 CCAGGCCTGTGGTGCTGTGGTCC 0: 1
1: 0
2: 8
3: 48
4: 810
Right 968574932 4:1361223-1361245 GTGGTCCTGGCCCCTGCAGCTGG No data
968574929_968574940 15 Left 968574929 4:1361207-1361229 CCAGGCCTGTGGTGCTGTGGTCC 0: 1
1: 0
2: 8
3: 48
4: 810
Right 968574940 4:1361245-1361267 GGACTCCAGGAAGCGGCCCGAGG 0: 1
1: 0
2: 0
3: 10
4: 140
968574929_968574935 2 Left 968574929 4:1361207-1361229 CCAGGCCTGTGGTGCTGTGGTCC 0: 1
1: 0
2: 8
3: 48
4: 810
Right 968574935 4:1361232-1361254 GCCCCTGCAGCTGGGACTCCAGG 0: 1
1: 0
2: 24
3: 1028
4: 12062

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968574929 Original CRISPR GGACCACAGCACCACAGGCC TGG (reversed) Intronic
900016585 1:154783-154805 AGATCACAGGACCACAGGACTGG - Intergenic
900046846 1:513375-513397 AGATCACAGGACCACAGGACCGG - Intergenic
900069051 1:755093-755115 AGATCACAGGACCACAGGACCGG - Intergenic
900122276 1:1053908-1053930 GGAACGCAGCACCACGGGCTGGG - Exonic
900345636 1:2209047-2209069 GGAGCAGAGCCCCCCAGGCCGGG + Intronic
900587468 1:3440089-3440111 GGGGCACAGCTCCAGAGGCCCGG - Intergenic
900930887 1:5736719-5736741 GCACCTCAGCACCCCAGCCCGGG - Intergenic
901042086 1:6370530-6370552 GCACCACTGCACTCCAGGCCAGG - Intronic
901478477 1:9507096-9507118 GGACAACAGCCCCACAGACCAGG + Intergenic
901628632 1:10637656-10637678 GGACCTCAGAGCCACTGGCCAGG + Exonic
901834152 1:11912880-11912902 GAAGCACAGCACCACAGGGAGGG + Intergenic
902059787 1:13632426-13632448 AGATCACAGGACCACAGGACCGG + Intergenic
902293207 1:15448379-15448401 GCACCACTGCACTACAGCCCAGG - Intronic
902303722 1:15521397-15521419 GAAGCACAGCACCACAGGGAGGG - Intronic
902628205 1:17688974-17688996 GGGCCTCATCACCTCAGGCCCGG - Intronic
902822600 1:18952331-18952353 GGACCCAGGCACCCCAGGCCAGG + Intronic
902964585 1:19990405-19990427 AGATCACAGGACCACAGGACGGG - Intergenic
902981360 1:20125804-20125826 GTACCACAGCACCCCAGCCTTGG + Intergenic
903202085 1:21749643-21749665 GGACCACTGCACCCCAGCCTTGG - Intronic
903565789 1:24264690-24264712 GGACCACAGCCCCACGGGATAGG - Intergenic
904280057 1:29412829-29412851 AGCCAACAGCTCCACAGGCCTGG - Intergenic
905042125 1:34968455-34968477 GCACCACAGCACCCCAGCCTGGG - Intergenic
905457637 1:38099424-38099446 GCACCACTGCACTCCAGGCCAGG - Intergenic
905567450 1:38977130-38977152 GCACCACAGCACTCCAGGCTGGG + Intergenic
905818059 1:40967348-40967370 GCACCACAGCACTACAGGCTGGG - Intergenic
906086458 1:43139259-43139281 GAAGCACAGCACCACAGGCAGGG - Intergenic
906201302 1:43962132-43962154 GGCCCACAGAAACAGAGGCCAGG - Intronic
907233869 1:53026763-53026785 GGACCACTGCACCCCAGCCTGGG + Intronic
907288842 1:53399684-53399706 GAAGCACAGCACCACAGGGAGGG - Intergenic
907506707 1:54924332-54924354 AGATCACAGGACCACAGGACCGG + Intergenic
907622540 1:55996086-55996108 AGATCACAGGACCACAGGACCGG + Intergenic
908019750 1:59887447-59887469 AGATCACAGGACCACAGGACTGG - Intergenic
908045274 1:60161817-60161839 AGATCACAGGACCACAGGACCGG + Intergenic
909254939 1:73408075-73408097 AGATCACAGGACCACAGGACTGG - Intergenic
909413366 1:75378894-75378916 TGCCCCCAGCACCACAGGGCAGG + Intronic
909464822 1:75961393-75961415 AGATCACAGGACCACAGGACTGG - Intergenic
909556540 1:76960417-76960439 AGATCACAGGACCACAGGACGGG + Intronic
909967369 1:81931710-81931732 GCACCACTGAAGCACAGGCCAGG - Intronic
910508483 1:87977335-87977357 GCACCAGAGCGCCCCAGGCCTGG + Intergenic
910657540 1:89633475-89633497 GGTTCCCAGCACCACACGCCGGG - Intronic
911083034 1:93951975-93951997 AGATCACAGGACCACAGGACTGG + Intergenic
911084416 1:93964656-93964678 ACAGCACAGCACCACAGGGCTGG + Intergenic
912303480 1:108540721-108540743 AGATCACAGGACCACAGGACCGG - Intergenic
912396562 1:109349300-109349322 GCACCACAGCACCCCAGCCTGGG + Intronic
912807181 1:112766394-112766416 AGATCACAGGACCACAGGACTGG - Intergenic
913024605 1:114824495-114824517 AGATCACAGGACCACAGGACTGG - Intergenic
913074761 1:115332616-115332638 GCAAAACAGCAGCACAGGCCTGG - Intronic
913444112 1:118931734-118931756 GGCCTGCAGCACCAGAGGCCAGG + Exonic
914701710 1:150139934-150139956 GCACCACAGCACTCCAGGCTGGG - Intronic
915146937 1:153800892-153800914 GAACCACAGGCCCAGAGGCCTGG - Intergenic
915233174 1:154461256-154461278 GAAGCACAGCACCACAGGGAGGG + Intronic
915402522 1:155634015-155634037 TGCCCCCAGCACCACAGGGCAGG - Intergenic
916009574 1:160692585-160692607 TGCCCCCAGCACCACAGGGCAGG + Intronic
916290312 1:163158710-163158732 GGACCACAGGACCACAGGACCGG + Intronic
916525666 1:165606766-165606788 GAAGCACAGCACCACAGGGAGGG + Intergenic
916626897 1:166567791-166567813 AGATCACAGGACCACAGGACTGG + Intergenic
916962697 1:169905236-169905258 GCACCACAGCACTGCAGTCCAGG - Intergenic
917943537 1:179946949-179946971 GCGCCACTGCACCCCAGGCCGGG + Intergenic
918031122 1:180812689-180812711 GGACCACTGCACCCCAGACCTGG - Intronic
920186533 1:204162736-204162758 GGTCCACTCCACCACAGCCCTGG - Intronic
920394105 1:205631572-205631594 CGGCCACAGCCCCACCGGCCGGG - Intronic
921058001 1:211558875-211558897 GCACCACTGCACTCCAGGCCTGG + Intergenic
922104410 1:222500486-222500508 AGATCACAGGACCACAGGACCGG - Intergenic
922694630 1:227723032-227723054 AGATCACAGGACCACAGGACTGG - Intergenic
922885642 1:229018494-229018516 GGACAGGACCACCACAGGCCTGG - Intergenic
924120203 1:240789782-240789804 AGATCACAGGACCACAGGACCGG - Intronic
924270353 1:242325928-242325950 GCACCACTGCACTACAGGCTGGG - Intronic
924346586 1:243078004-243078026 AGATCACAGGACCACAGGACTGG - Intergenic
924490003 1:244527037-244527059 AGATCACAGGACCACAGGACCGG + Intronic
924642041 1:245843196-245843218 GGAAGAAAGCAACACAGGCCAGG + Intronic
1062907109 10:1186596-1186618 GCACCACAGGACAGCAGGCCAGG - Intronic
1063024797 10:2167210-2167232 GCACCACAGCACTCCAGCCCTGG - Intergenic
1063320468 10:5047149-5047171 GAAGCACAGCACCACAGGGAGGG + Intronic
1064148316 10:12842516-12842538 AGACCACAGATCCACAGCCCAGG - Intergenic
1064247320 10:13679382-13679404 GGTCCACTGCACCACAGCCTGGG + Intronic
1064893638 10:20209035-20209057 GGACCACAGGACCACAGGACGGG + Intronic
1065053401 10:21818424-21818446 AGATCACAGGACCACAGGACTGG - Intronic
1066392959 10:34993542-34993564 GCACCACTGCACTCCAGGCCTGG + Intergenic
1066729762 10:38426845-38426867 AGATCACAGGACCACAGGACCGG + Intergenic
1067179085 10:43971520-43971542 GTAGCAAAGCACCATAGGCCAGG - Intergenic
1067794631 10:49311792-49311814 GGCACAGGGCACCACAGGCCTGG + Intronic
1068139465 10:52986968-52986990 GCGCCACTGCACCACAGCCCAGG + Intergenic
1068290835 10:55000015-55000037 AGATCACAGGACCACAGGACAGG + Intronic
1068388595 10:56362228-56362250 GCGCCACAGCACTACAGCCCTGG + Intergenic
1068429318 10:56911593-56911615 GAAGCACAGCACCACAGGGAGGG + Intergenic
1068515648 10:58022185-58022207 AGATCACAGGACCACAGGACCGG - Intergenic
1068662567 10:59637621-59637643 AGATCACAGGACCACAGGACGGG + Intergenic
1069270628 10:66522612-66522634 GACCCACAGCTCCACAGGGCTGG - Intronic
1069737731 10:70668501-70668523 AGATCACAGGACCACAGGACCGG - Intergenic
1069820024 10:71221646-71221668 GCACCCCAGCATCACAGGCCAGG - Intronic
1070050340 10:72882704-72882726 AGATCACAGGACCACAGGACCGG - Intronic
1070170755 10:73931142-73931164 GAAGCACAGCACCACAGGGAGGG + Intergenic
1070283270 10:75065731-75065753 GAACCACTGCACCACAGCCTGGG - Intergenic
1070586904 10:77773274-77773296 GAAGCACAGCACCACAGGGAGGG + Intergenic
1070697432 10:78573374-78573396 GCACCAGAGCACCACTGCCCAGG - Intergenic
1070825245 10:79386924-79386946 GGCCCACAGCAACGGAGGCCTGG + Intronic
1071588983 10:86853838-86853860 AGATCACAGGACCACAGGACGGG + Intronic
1071945463 10:90638895-90638917 AGATCACAGGACCACAGGACTGG - Intergenic
1072068585 10:91894436-91894458 GAAGCACAGCACCACAGGGAGGG - Intergenic
1072917147 10:99545033-99545055 GGAACACAGCAGAACAGCCCAGG - Intergenic
1072947917 10:99827096-99827118 TGCCCCCAGCACCACAGGGCAGG - Intronic
1073342877 10:102759031-102759053 GAAGCACAGCACCACAGGGAGGG + Intronic
1073678606 10:105677944-105677966 AGATCACAGGACCACAGGACTGG - Intergenic
1074165706 10:110872146-110872168 GGACCCCCGCACCGCAGGCCCGG - Intronic
1074983808 10:118640304-118640326 AGATCACAGGACCACAGGACCGG + Intergenic
1075501513 10:122979417-122979439 GGACCACTGCACTCCAGTCCGGG + Intronic
1076342099 10:129756282-129756304 GGTACCCAGCACCACAGGACAGG + Intronic
1076437696 10:130457689-130457711 GCACCACTGCACTCCAGGCCAGG - Intergenic
1076775670 10:132696807-132696829 AGACCACAGCACCCAGGGCCGGG + Intronic
1076973175 11:149852-149874 AGATCACAGGACCACAGGACTGG - Intergenic
1076998388 11:310505-310527 GGTCCCCAGCACCACAGAGCAGG - Intronic
1077000354 11:319253-319275 GGTCCCCAGCACCACAGAGCAGG + Intergenic
1077318057 11:1928063-1928085 GGACCAGTGCACCCCAGGCCAGG + Intronic
1078263040 11:9729539-9729561 GCACCACTGCACTACAGCCCGGG - Intronic
1078325541 11:10377838-10377860 GCACCACAGCACACCAGGCTGGG + Intronic
1078907121 11:15697885-15697907 AGAGCACAGCTCCAAAGGCCGGG + Intergenic
1078930099 11:15906033-15906055 GGACCGAAGCACCAGATGCCGGG - Intergenic
1080070903 11:28085367-28085389 GAAGCACAGCACCACAGGGAGGG - Intronic
1080875626 11:36271795-36271817 GGACCTCATCATCACTGGCCTGG + Intergenic
1081009906 11:37798050-37798072 AGATCACAGGACCACAGGACCGG + Intergenic
1081167144 11:39820387-39820409 CCACCACAGGACCAGAGGCCTGG - Intergenic
1081254097 11:40871210-40871232 AGATCACAGGACCACAGGACAGG - Intronic
1081494774 11:43597686-43597708 GCACCACTGCACTACAGCCCGGG - Intronic
1081709261 11:45206419-45206441 GCAGCACAGCAGCACAGGCTTGG - Intronic
1081732078 11:45378704-45378726 GGACTGCAGCAGCACAGGACTGG + Intergenic
1082662074 11:55924197-55924219 AGATCACAGGACCACAGGACTGG + Intergenic
1082919212 11:58474016-58474038 AGATCACAGGACCACAGGACCGG - Intergenic
1083060020 11:59860175-59860197 GGACCACAGCACTCCAGCCTGGG - Intronic
1083311357 11:61785532-61785554 GGAACCCAGCACAACAGGACTGG + Intronic
1083462611 11:62824548-62824570 GAACCACAGCACCACCGCCTGGG + Exonic
1083875551 11:65522279-65522301 GAAGCACAGCACCACAGGGAGGG + Intergenic
1083897291 11:65626263-65626285 GGACCAGGGCAACACAGGCAAGG - Intronic
1084097996 11:66925125-66925147 AGATCACAGGACCACAGGACCGG + Intronic
1084441433 11:69176289-69176311 GCACCACTGCACCCCAGCCCAGG - Intergenic
1084459912 11:69290990-69291012 GGACCACAGCTCCAATGGCGTGG - Intergenic
1084481134 11:69420831-69420853 GGCCCACATCCCCACAGGCCTGG - Intergenic
1084546429 11:69817320-69817342 GCACCACAGCACCCCTGGGCTGG - Intronic
1084563460 11:69916799-69916821 ACACCACAGCACCCCAGCCCTGG + Intergenic
1084767624 11:71323002-71323024 GGACAAGAGCACCCCAGACCTGG - Intergenic
1084828684 11:71751338-71751360 AGATCACAGGACCACAGGACCGG - Intergenic
1085048962 11:73369882-73369904 GGTCCTCAACACCACAGGACGGG + Intergenic
1087611406 11:100438411-100438433 GGAACACAACACCACATCCCCGG - Intergenic
1087723907 11:101696871-101696893 TGCCCCCAGCACCACAGGGCAGG + Intronic
1088297080 11:108311008-108311030 GCACCACTGCACCACAGCCTGGG - Intronic
1088797081 11:113273440-113273462 GGCTCCCAGCACCAAAGGCCCGG + Intronic
1089471931 11:118728344-118728366 TGCCCCCAGCACCACAGGGCAGG - Intergenic
1089536593 11:119164166-119164188 GTACCACTGCACTACAGCCCAGG - Intergenic
1089858663 11:121569720-121569742 AGATCACAGGACCACAGGACGGG - Intronic
1090222892 11:125046052-125046074 AGATCACAGGACCACAGGACTGG - Intergenic
1090389700 11:126381076-126381098 GCAGGACAGCACCACAGGCCCGG - Intronic
1092112117 12:5971231-5971253 GGACCACATCAACCCAGGCAGGG - Intronic
1092914856 12:13180427-13180449 AGATCACAGGACCACAGGACCGG + Intergenic
1093066646 12:14665171-14665193 GGGCCACTGCACTCCAGGCCGGG + Intronic
1093074713 12:14745934-14745956 AGATCACAGGACCACAGGACTGG + Intergenic
1094411762 12:30174419-30174441 AGATCACAGGACCACAGGACTGG - Intergenic
1094416594 12:30222719-30222741 AGATCACAGGACCACAGGACTGG - Intergenic
1094552207 12:31463214-31463236 GTACCACTGCACTCCAGGCCTGG + Intronic
1094639346 12:32258874-32258896 GAAGCACAGCACCACAGGGAGGG + Intronic
1095172748 12:39055048-39055070 AGATCACAGGACCACAGGACCGG - Intergenic
1095363467 12:41373185-41373207 AGATCACAGGACCACAGGACCGG + Intronic
1095717272 12:45360195-45360217 GTAACACAGTACCACAGACCAGG + Intronic
1095944373 12:47745757-47745779 TGACTGCAGCCCCACAGGCCAGG + Intronic
1096113797 12:49043494-49043516 GTCCCACAGCCCTACAGGCCAGG + Intronic
1096676594 12:53229675-53229697 GGGCCACAGCTCAACTGGCCAGG + Intronic
1096768616 12:53916190-53916212 GGATCCCAGCACCTGAGGCCAGG - Intergenic
1097011190 12:55954559-55954581 GGACCATGCCACCCCAGGCCTGG + Intronic
1097331274 12:58335085-58335107 TGCCCCCAGCACCACAGGGCAGG - Intergenic
1097839656 12:64309551-64309573 GCACCACTGCACCACAGCCTGGG - Intronic
1098366101 12:69705098-69705120 GCACCACTGCACTCCAGGCCGGG - Intergenic
1098459366 12:70715352-70715374 AGACCACAGGACTACAGGACCGG + Intronic
1098625435 12:72660300-72660322 GAAGCACAGCACCACAGGGAGGG + Intronic
1098781143 12:74687889-74687911 AGATCACAGGACCACAGGACCGG + Intergenic
1099117774 12:78648994-78649016 AGATCACAGGACCACAGGACTGG - Intergenic
1099721302 12:86364880-86364902 AGATCACAGGACCACAGGACTGG + Intronic
1100499125 12:95156565-95156587 AGATCACAGGACCACAGGACGGG - Intronic
1100520396 12:95369551-95369573 GGACCACAGCACTCCAGCCTGGG - Intergenic
1101174084 12:102130810-102130832 ACACCACTGCACCACAGCCCAGG + Intronic
1102256834 12:111420323-111420345 GCACCACAGCACTACAGCCTGGG + Intronic
1103712697 12:122924679-122924701 GGAGCACGGCACCCCAGGGCTGG - Intronic
1103777254 12:123375401-123375423 GCACCACTGCACCACAGCCTGGG + Intergenic
1103809562 12:123602459-123602481 AGACCACAGCACCCGAGGGCGGG - Intronic
1103811411 12:123617011-123617033 GGACTACAGGAACACACGCCTGG - Intronic
1104693223 12:130842208-130842230 AGATCACAGGACCACAGGACCGG - Intergenic
1104772921 12:131375532-131375554 AGACGACAGCAGCACAGGACGGG - Intergenic
1104786485 12:131453027-131453049 GCACCACTGCACTACAGGCTAGG - Intergenic
1105227640 13:18451291-18451313 AGATCACAGGACCACAGGACCGG + Intergenic
1106058707 13:26264326-26264348 GCACCACAGCACTCCAGCCCAGG - Intronic
1106715898 13:32387628-32387650 GAAGCACAGCACCACAGGGAGGG - Intronic
1106961037 13:34998294-34998316 AGATCACAGGACCACAGGACTGG + Intronic
1107586993 13:41861166-41861188 GCACCACTGCACTACAGCCCGGG + Intronic
1108294659 13:49001834-49001856 AGATCACAGGACCACAGGACTGG - Intronic
1108500636 13:51066787-51066809 GGACCACAACGCCACAGACTGGG + Intergenic
1109141886 13:58723506-58723528 GCACCACAGCACCCCAGCCTGGG - Intergenic
1109424386 13:62151966-62151988 AGATCACAGGACCACAGGACTGG - Intergenic
1109746156 13:66625701-66625723 GCACCACAGCACTACAGCCTGGG - Intronic
1111509596 13:89243312-89243334 AGATCACAGGACCACAGGACCGG - Intergenic
1111712108 13:91829916-91829938 AGATCACAGGACCACAGGACTGG + Intronic
1113231356 13:108217082-108217104 TAACAACAACACCACAGGCCGGG + Intronic
1113290565 13:108901174-108901196 AGATCACAGGACCACAGGACTGG - Intronic
1113595563 13:111529473-111529495 GAACCCCAGCAACTCAGGCCTGG - Intergenic
1113815272 13:113165571-113165593 GGACCACTGCACTCCAGGCTGGG - Intronic
1113950081 13:114066870-114066892 GCCCCAGAGCACCCCAGGCCAGG - Intronic
1114355557 14:21904085-21904107 AGATCACAGGACCACAGGACTGG - Intergenic
1114666760 14:24382050-24382072 GAACCAAAGCACCACAAACCGGG + Intergenic
1114892409 14:26942148-26942170 AGATCACAGGACCACAGGACTGG + Intergenic
1115608752 14:35031970-35031992 GGACCACTGCACTCCAGGCTGGG + Intergenic
1115884719 14:37958567-37958589 AGATCACAGGACCACAGGACCGG - Intronic
1116562766 14:46402398-46402420 AGATCACAGGACCACAGGACCGG - Intergenic
1116890280 14:50261072-50261094 GCACCACTGCACTACAGCCCAGG + Intronic
1118376153 14:65178931-65178953 AGATCACAGGACCACAGGACGGG + Intergenic
1118417046 14:65551131-65551153 GGCTCATAGCACAACAGGCCAGG + Intronic
1118853181 14:69600568-69600590 GTCCCACAGCACCTCAGCCCTGG + Intergenic
1119255061 14:73188602-73188624 GCACCACTGCACCCCAGGCTGGG + Intronic
1119386506 14:74260775-74260797 GGAGCACAGCACCAAAGTGCTGG + Exonic
1119959823 14:78842502-78842524 AGATCACAGGACCACAGGACTGG + Intronic
1121562029 14:94882900-94882922 TAACCACACCACCACAGTCCCGG - Intergenic
1122703706 14:103607241-103607263 GCACCACAGCACCACACGCTGGG - Intronic
1123017883 14:105384242-105384264 GGAAGGCAGCAGCACAGGCCTGG + Intronic
1123664291 15:22595939-22595961 AGATCACAGGACCACAGGACCGG - Intergenic
1123690348 15:22833453-22833475 AGATCACAGGACCACAGGACGGG + Intergenic
1123716967 15:23040376-23040398 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123717058 15:23040671-23040693 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123717693 15:23042788-23042810 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123718030 15:23043944-23043966 GCCCCACAGCACCGCTGGCCAGG - Intergenic
1123718086 15:23044127-23044149 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123718377 15:23045154-23045176 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123718746 15:23046449-23046471 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123718909 15:23047009-23047031 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123719124 15:23047752-23047774 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123719186 15:23047970-23047992 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123719261 15:23048232-23048254 GCCCCACAGCACCACTGGCTAGG - Intergenic
1123719413 15:23048759-23048781 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123845545 15:24297443-24297465 AGATCACAGGACCACAGGACTGG + Intergenic
1123864587 15:24505233-24505255 AGATCACAGGACCACAGGACTGG + Intergenic
1123868093 15:24542480-24542502 AGATCACAGGACCACAGGACTGG + Intergenic
1124144615 15:27112481-27112503 GTACCACAGCACTCCAAGCCTGG - Intronic
1124565312 15:30807110-30807132 AGATCACAGGACCACAGGACTGG + Intergenic
1125407722 15:39370536-39370558 AGATCACAGGACCACAGGACCGG + Intergenic
1125567306 15:40686356-40686378 AGATCACAGGACCACAGGACTGG + Intergenic
1126379307 15:48029617-48029639 GTATCACAGCACCCCAGGGCAGG + Intergenic
1127072280 15:55298529-55298551 AGATCACAGGACCACAGGACTGG + Intronic
1127417078 15:58768682-58768704 GAAGCACAGCACCACAGGGAGGG - Intergenic
1127755088 15:62084351-62084373 AGATCACAGGACCACAGGACTGG + Intergenic
1127963743 15:63908692-63908714 GGACCACGGGACTACAAGCCAGG + Intronic
1128358476 15:66944355-66944377 CCACCACAGCTCCAAAGGCCAGG + Intergenic
1128535131 15:68484854-68484876 GGACAGCAACACCACAGGGCAGG + Intergenic
1128834178 15:70795750-70795772 GTACCACTGCTCCACAGGCGCGG + Intergenic
1129027873 15:72595870-72595892 GCACCACTGCACCACAGCCTGGG - Exonic
1129218743 15:74118349-74118371 AGATCACAGGACCACAGGACCGG + Intronic
1129350542 15:74953599-74953621 GCACCACAGCACTCCAGCCCGGG + Intergenic
1129421704 15:75432996-75433018 GCACCACTGCACCCCAGGCTGGG + Intronic
1129468083 15:75735104-75735126 GAAGCACAGCACCACAGGGAGGG - Intergenic
1129468529 15:75737855-75737877 GGCCCACAGGAGCAGAGGCCAGG - Intergenic
1129701495 15:77771079-77771101 GGATAACAGCATCACAGACCTGG + Intronic
1129726192 15:77903013-77903035 GCACCCTAGAACCACAGGCCAGG + Intergenic
1129727051 15:77906652-77906674 GGCCCACAGGAGCAGAGGCCAGG + Intergenic
1129865278 15:78902734-78902756 GAAGCACAGCACCACAGGGAGGG + Intergenic
1129969148 15:79762035-79762057 AGATCACAGGACCACAGGACCGG + Intergenic
1130011479 15:80155983-80156005 GAAGCACAGCACCACAGGGAGGG + Intronic
1130348968 15:83073832-83073854 GGGCAGCAGCACCCCAGGCCTGG + Intergenic
1130513893 15:84611150-84611172 GGTGCACACCACCACATGCCCGG - Intronic
1130554270 15:84911814-84911836 GCACCACTGCACTCCAGGCCAGG + Intronic
1131150289 15:90043330-90043352 TGTGCACAGCATCACAGGCCAGG + Intronic
1131382678 15:91976890-91976912 AGATCACAGGACCACAGGACCGG + Intronic
1131589709 15:93735366-93735388 AGATCACAGGACCACAGGACTGG - Intergenic
1132213735 15:100047281-100047303 AGATCACAGGACCACAGGACCGG - Intronic
1132226585 15:100146998-100147020 AGATCACAGGACCACAGGACCGG - Intronic
1132509752 16:333287-333309 GCACCACTGCACCCCAGCCCGGG + Intronic
1132744578 16:1431391-1431413 GGACCACAGCTGGGCAGGCCAGG + Intergenic
1132934087 16:2472289-2472311 GGACAGCAGCCCCCCAGGCCTGG + Exonic
1133627774 16:7588134-7588156 GCACCACTGCACCACAGCCTCGG + Intronic
1133637136 16:7677883-7677905 GAACTACATCACAACAGGCCAGG - Intronic
1133934689 16:10259152-10259174 GAAGCACAGCACCACAGGGAGGG - Intergenic
1134123698 16:11601853-11601875 GGACTACAAAGCCACAGGCCAGG - Intronic
1134651324 16:15911198-15911220 GGACCACTGCACCCCAGCCTGGG + Intergenic
1135270282 16:21063583-21063605 GCACCACTGCACTCCAGGCCGGG - Intronic
1135301158 16:21328650-21328672 AGATCACAGGACCACAGGACTGG - Intergenic
1135963884 16:27020190-27020212 AGACCATAGCACCTCAGGCTGGG + Intergenic
1136091400 16:27922824-27922846 GCACCACTGCACCACAGCCCGGG - Intronic
1136111630 16:28067126-28067148 GAACCACAGCACTCCAGCCCGGG + Intergenic
1136595405 16:31245647-31245669 AGATCACAGGACCACAGGACTGG + Intergenic
1136635284 16:31517506-31517528 AGATCACAGGACCACAGGACTGG - Intergenic
1136710373 16:32232077-32232099 GAAGCACAGCACCACAGGGAGGG + Intergenic
1136757539 16:32697334-32697356 GAAGCACAGCACCACAGGGAGGG - Intergenic
1136810567 16:33173041-33173063 GAAGCACAGCACCACAGGGAGGG + Intergenic
1136817043 16:33283121-33283143 GAAGCACAGCACCACAGGGAGGG + Intronic
1137061514 16:35794962-35794984 GGACAGCAGCTCCACAGCCCAGG + Intergenic
1137560841 16:49501200-49501222 GGACAAGTGCAGCACAGGCCAGG + Intronic
1139000858 16:62508195-62508217 AGATCACAGGACCACAGGACAGG + Intergenic
1139497973 16:67335016-67335038 AGATCACAGGACCACAGGACCGG + Intronic
1139512380 16:67434882-67434904 GGTGCGCATCACCACAGGCCTGG - Intronic
1139563183 16:67756658-67756680 GCACCACTGCACCCCAGGCTGGG + Intronic
1139961742 16:70721928-70721950 GGAGCACAGGACCCCAGGCCCGG + Intronic
1140761335 16:78111674-78111696 GAAACACAGCACCACAGGGAGGG - Intronic
1141692380 16:85603541-85603563 GCACCACTGCACCACAGCCTGGG - Intergenic
1142114937 16:88351646-88351668 GGACCTCAGATCCACAGCCCAGG - Intergenic
1142447075 16:90147674-90147696 AGATCACAGGACCACAGGACCGG + Intergenic
1203059687 16_KI270728v1_random:957683-957705 GAAGCACAGCACCACAGGGAGGG - Intergenic
1142460417 17:87657-87679 AGATCACAGGACCACAGGACCGG - Intergenic
1143499974 17:7333028-7333050 GAAGCACAGCACCACAGGGAGGG + Intergenic
1145279510 17:21457588-21457610 GGACCACAGCCCCCCCTGCCTGG + Intergenic
1146006886 17:29166178-29166200 GGACCACACGCCGACAGGCCTGG + Exonic
1147031502 17:37641357-37641379 GCACCACTGCACCACAGACTGGG + Intronic
1147218502 17:38914620-38914642 GGACCAGAGGACCTGAGGCCGGG + Intronic
1147418763 17:40311694-40311716 GGAGCCCTGCACCACAGGCAGGG - Intronic
1147591408 17:41686099-41686121 AGACCACAGGACCACAGGACCGG - Intergenic
1147661630 17:42120069-42120091 GGACCCCTCCACCACAGGCCGGG + Exonic
1147719208 17:42528135-42528157 GCACCACAGCACTGCAGGCCAGG - Intergenic
1147719626 17:42531006-42531028 GCACCACAGCACTCCAGGCCAGG - Intergenic
1147764464 17:42824336-42824358 GGTCCACAGGCTCACAGGCCCGG + Intronic
1147840177 17:43365888-43365910 AGATCACAGGACCACAGGACTGG + Intergenic
1147841178 17:43372648-43372670 GAAGCACAGCACCACAGGGAGGG + Intergenic
1149444116 17:56700347-56700369 GCACCACGGCACCCCAGGCTGGG + Intergenic
1149958449 17:61079932-61079954 GCACCACAGCACTCCAGCCCAGG - Intronic
1150164517 17:62928595-62928617 GGATCACAGCACCACATGGGAGG - Intergenic
1150363342 17:64558354-64558376 GCACCACTGCACCCCAGGCTGGG + Intronic
1150777762 17:68095372-68095394 GGGCCACAGCACAACAGGGCTGG + Intergenic
1151365487 17:73613736-73613758 GGTCCACAGCAGGACAGGCCTGG + Intronic
1151820672 17:76495066-76495088 GTGCCACAGCAACACAGGCTCGG + Intronic
1151954353 17:77373179-77373201 GGGCCCCAGCCCCCCAGGCCTGG + Intronic
1152165207 17:78699826-78699848 GCACCACAGCACTCCAAGCCTGG - Intronic
1152199204 17:78935328-78935350 GAACCACAGTCCCACAGGACAGG - Intergenic
1152208983 17:78992983-78993005 TGCCCACAGCTGCACAGGCCAGG - Exonic
1152668741 17:81588401-81588423 GTGCCACTGCACTACAGGCCTGG - Intronic
1152903093 17:82956529-82956551 CCACAACAGCACCACAGACCAGG - Intronic
1153238037 18:3007212-3007234 GCACCACTGCACTACAGCCCTGG - Intronic
1153715828 18:7847207-7847229 GCACCACAGCACTCCAGGCTGGG - Intronic
1153966842 18:10190126-10190148 GGATGACATCACTACAGGCCAGG + Intergenic
1154047656 18:10922040-10922062 AGATCACAGGACCACAGGACCGG - Intronic
1154525742 18:15288185-15288207 AGATCACAGGACCACAGGACCGG - Intergenic
1155397340 18:25400545-25400567 GCACCACTGCACTCCAGGCCAGG + Intergenic
1155481125 18:26288590-26288612 GCACCACAGCACTACAGCCTGGG + Intronic
1155854531 18:30816250-30816272 AGATCACAGGACCACAGGACCGG - Intergenic
1156450925 18:37266178-37266200 TGACACCAGCACCACAGGCGAGG - Intronic
1156761434 18:40596298-40596320 AGATCACAGGACCACAGGACCGG + Intergenic
1157744577 18:50123662-50123684 GTACCACTGCACTCCAGGCCTGG + Intronic
1158113038 18:53963027-53963049 AGATCACAGGACCACAGGGCTGG - Intergenic
1158705140 18:59785676-59785698 GTACCACTGCACTCCAGGCCTGG + Intergenic
1158759151 18:60364293-60364315 GGGCCACTGCACTCCAGGCCAGG - Intergenic
1159062462 18:63530299-63530321 AGACCACACCACCATAGGCCTGG + Intergenic
1159686213 18:71424042-71424064 AGATCACAGGACCACAGGACTGG - Intergenic
1160030814 18:75258012-75258034 GGAGCACTGCTCCACAGGCCGGG - Intronic
1160060520 18:75525272-75525294 ATAACACAGCATCACAGGCCAGG + Intergenic
1160083342 18:75751875-75751897 GCACCACTGCACCACAGCCTGGG + Intergenic
1160328026 18:77968370-77968392 GGACCACAGCACTACTGACATGG + Intergenic
1160650132 19:220157-220179 AGATCACAGGACCACAGGACCGG - Intergenic
1160742421 19:693362-693384 GGACCACAGAAGCACAGCTCCGG + Intronic
1160901749 19:1432340-1432362 GGACCACAGAGCCACGGTCCCGG - Intronic
1161305782 19:3566814-3566836 GTACCACAGTACCACAGTACTGG - Intronic
1161438235 19:4276782-4276804 GCACCACTGCACTCCAGGCCCGG + Intergenic
1161467500 19:4439863-4439885 GCACCACTGCACCACAGCCTGGG + Intronic
1161683759 19:5693239-5693261 GGCCCACACCACCACGGGACAGG - Intronic
1161870949 19:6869449-6869471 GAAGCACAGCACCACAGGGAGGG - Intergenic
1162292550 19:9791094-9791116 GAAGCACAGCACCACAGGGAGGG + Intronic
1163150023 19:15405877-15405899 GCACCACTGCACTACAGGCTAGG + Intronic
1163232567 19:16014496-16014518 GGAGCACAGCACCACAAGGAGGG + Intergenic
1163235925 19:16030563-16030585 GGAACACAGCACCACAGGGAGGG + Intergenic
1164339339 19:24372162-24372184 GGATCACAGAACCACAGGACCGG - Intergenic
1164371172 19:27645591-27645613 TGCCCCCAGCACCACAGGGCAGG - Intergenic
1164549596 19:29198128-29198150 GGACCACAGGACCACAGGACTGG + Intergenic
1165023815 19:32944988-32945010 GGACCAAACCACCAAAAGCCAGG + Intronic
1165363820 19:35352004-35352026 GGACCACAGCAACACCTCCCTGG + Exonic
1165432576 19:35781047-35781069 GCACCTCAGCAACTCAGGCCAGG + Exonic
1165787612 19:38471485-38471507 GCACCACAGCACTCCAGCCCAGG + Intronic
1165852785 19:38859981-38860003 GGAGCACAGCACCACAGGGAGGG + Intergenic
1165922004 19:39305166-39305188 GCACCAGAGAATCACAGGCCAGG - Intergenic
1166060912 19:40324915-40324937 GTACCACAGCACTCCAGCCCAGG + Intronic
1166165932 19:40988669-40988691 AGATCACAGGACCACAGGACCGG - Intergenic
1166222571 19:41375172-41375194 GGGCCACAGGAACACAGCCCGGG + Intronic
1166681554 19:44770737-44770759 GGACCACAGTCCCAGAGGCGTGG + Intergenic
1167116901 19:47493666-47493688 GGGCCCCAGCACTAGAGGCCTGG + Intronic
1167278201 19:48551636-48551658 GGACCACGGCAGCACAGACAGGG - Intergenic
1167430658 19:49452585-49452607 GGACCACTGCACTCCAGCCCTGG + Intronic
1167513919 19:49911772-49911794 GGGCCACAGCATCCCAGCCCCGG - Intronic
1167696021 19:51015973-51015995 GGGCCCCAGCACTACGGGCCTGG + Exonic
1167895537 19:52577825-52577847 GAAGCACAGCACCACAGGGAGGG - Intronic
1167927741 19:52835191-52835213 GAAGCACAGCACCACAGGGAGGG + Intronic
1167935959 19:52908801-52908823 GCACCACTGCACCACAGCCTGGG + Intergenic
1167939122 19:52932114-52932136 GAAGCACAGCACCACAGGGAGGG - Intronic
1168058585 19:53877767-53877789 GAAGCACAGCACCACAGGGAGGG + Intergenic
1168084739 19:54037246-54037268 GAAGCACAGCACCACAGGGAGGG - Intergenic
1168292207 19:55362219-55362241 GGATCCCAGCTCCACAGACCAGG - Intronic
1168509465 19:56962595-56962617 GGACCACAGCACCAACGCCAAGG - Intergenic
1168726390 19:58584695-58584717 GAAGCACAGCACCACAGGGAGGG - Intergenic
925386416 2:3464889-3464911 GGGCCAGACCACCACAGGCAGGG + Intronic
926556298 2:14362178-14362200 AGATCACAGGACCACAGGACCGG + Intergenic
926859096 2:17290288-17290310 AGATCACAGGACCACAGGACCGG + Intergenic
926874158 2:17456760-17456782 AGATCACAGGACCACAGGACCGG + Intergenic
927195712 2:20545042-20545064 AGATCACAGGACCACAGGACCGG + Intergenic
927210780 2:20637801-20637823 GGAGGACAGCACCCCTGGCCTGG + Intronic
927520076 2:23693229-23693251 GGACCACTGACCCAAAGGCCCGG - Intronic
927757005 2:25716764-25716786 GTACCACAGGAACACAGGGCAGG - Intergenic
928708389 2:33976977-33976999 AGATCACAGGACCACAGGACCGG - Intergenic
928901592 2:36323959-36323981 AGATCACAGGACCACAGGACTGG - Intergenic
929362715 2:41113712-41113734 AGATCACAGGACCACAGGACCGG + Intergenic
929843580 2:45497959-45497981 GCACCACAGCACCCCAGCCTGGG + Intronic
930489546 2:52050995-52051017 AGATCACAGGACCACAGGACCGG - Intergenic
931116670 2:59173288-59173310 GAAGCACAGCACCACAGGGAGGG - Intergenic
931581792 2:63783375-63783397 GCACCACTGCACCACAGTCTGGG + Intronic
931602228 2:64016649-64016671 GCACCACTGCACTACAGGCTGGG - Intronic
932479315 2:72029107-72029129 GCTCCACAGCAGCCCAGGCCTGG + Intergenic
932881787 2:75508589-75508611 AGATCACAGGACCACAGGACTGG - Intronic
933611839 2:84444527-84444549 GGACCACAGGACCACAGGACCGG + Intronic
933761342 2:85674319-85674341 GGAACAAAGCACCACAAGCTGGG - Intergenic
933774582 2:85764475-85764497 GCACCAGAGCACCTAAGGCCAGG - Intronic
935936924 2:108195945-108195967 GGACCACAGGCCCCCATGCCCGG - Intergenic
936021255 2:108996634-108996656 GGACAACAGCACAGCAGGCTTGG - Intergenic
936234556 2:110732287-110732309 GGACCTGGGCACCAGAGGCCCGG - Intergenic
936686748 2:114836575-114836597 AGATCACAGGACCACAGGACTGG + Intronic
936874163 2:117168094-117168116 GGATCACAGGACCACAGGACGGG + Intergenic
937040736 2:118818787-118818809 GGCCCACAGGCCCACAGACCTGG + Intergenic
937307893 2:120883442-120883464 GCACCACTGCACCCCAGCCCAGG + Intronic
937435908 2:121881114-121881136 GGACCACAGAACCACTTGCAGGG - Intergenic
937684701 2:124682537-124682559 GGACCACTGGACCACTGGACTGG + Intronic
938375781 2:130805512-130805534 GCACCACTGCACTCCAGGCCTGG - Intergenic
938524841 2:132119546-132119568 AGATCACAGGACCACAGGACCGG - Intergenic
938538849 2:132268828-132268850 GCACCACTGCACTACAGCCCAGG - Intergenic
938545240 2:132322847-132322869 GCACCACAGCACTCCAGCCCAGG + Intergenic
938790612 2:134672516-134672538 GGACCACAGCCACACCTGCCTGG + Intronic
938802399 2:134775173-134775195 TCACCACAGCATGACAGGCCAGG + Intergenic
938842510 2:135176630-135176652 GCACCACAGCACTCCATGCCTGG + Intronic
939246085 2:139625363-139625385 AGATCACAGGACCACAGGACCGG + Intergenic
940920235 2:159297772-159297794 GCACCACAGCACCCCAGCCTGGG - Intergenic
941523236 2:166574997-166575019 GCACCACTGCACTCCAGGCCTGG + Intergenic
942238195 2:173932947-173932969 GCACCACTGCACTCCAGGCCTGG + Intronic
942478282 2:176352986-176353008 AGATCACAGGACCACAGGACTGG + Intergenic
944178638 2:196862431-196862453 AGATCACAGGACCACAGGACCGG - Intronic
944397115 2:199280810-199280832 AGATCACAGGACCACAGGACAGG - Intronic
945062161 2:205918839-205918861 GGAACACAGCTCCAGGGGCCAGG + Intergenic
945488303 2:210424756-210424778 AGATCACAGGACCACAGGACCGG + Intergenic
945897236 2:215497496-215497518 AGATCACAGGACCACAGGACCGG - Intergenic
946240907 2:218355057-218355079 GGAGCACAGCACCACAGGGAGGG - Intergenic
946609367 2:221441265-221441287 GTACCACTGCACCCCAGTCCAGG - Intronic
947428979 2:230009187-230009209 GGGGCACAGCACAACAGGGCTGG + Intronic
947860111 2:233352636-233352658 AGAGCACTGCACCATAGGCCGGG + Intergenic
947974363 2:234352242-234352264 GAAGCACAGCACCACAGGGAGGG - Intergenic
948012884 2:234664115-234664137 AGATCACAGGACCACAGGACTGG - Intergenic
948017531 2:234702392-234702414 GGACCACAGTTCCACATGGCTGG - Intergenic
948287996 2:236802174-236802196 AGAGCAAAGCACCACAGACCAGG + Intergenic
948558464 2:238834751-238834773 TGACCACGCCACCACAGGGCAGG + Intergenic
1168842910 20:921189-921211 GCAGCACAGGACCAGAGGCCTGG - Intergenic
1168882180 20:1216489-1216511 GAAGCACAGCACCACAGGGAGGG - Intergenic
1168930372 20:1618686-1618708 TGACCCCAGAACCACAGGGCTGG - Intronic
1168961980 20:1876258-1876280 GGACCACAGCTTTAGAGGCCTGG + Intergenic
1169613739 20:7414320-7414342 AGATCACAGGACCACAGGACGGG + Intergenic
1171459553 20:25291070-25291092 GGCCCACAACCCCACTGGCCTGG - Intronic
1171492446 20:25530823-25530845 AGATCACAGGACCACAGGACTGG + Intronic
1171506683 20:25642108-25642130 GCACCACTGCACTCCAGGCCGGG - Intergenic
1171867760 20:30500753-30500775 GCACCACTGCACTACAGCCCAGG - Intergenic
1172159526 20:32856724-32856746 GCACCACAGCACTCCAGCCCGGG - Intergenic
1172916387 20:38446930-38446952 GGACCACTGCACCAGCGGCTGGG - Intergenic
1173031490 20:39365220-39365242 GCACCACTGCACTCCAGGCCTGG + Intergenic
1173840321 20:46152780-46152802 GCACCACTGCACTCCAGGCCTGG - Intergenic
1174075607 20:47933669-47933691 GGACCACAGCCACCCAGTCCTGG - Intergenic
1174193789 20:48758498-48758520 GCACCGCAGCCACACAGGCCAGG + Intronic
1174666103 20:52259367-52259389 GGGCCACAGCATCACACTCCAGG + Intergenic
1175728266 20:61334061-61334083 TGACCAGAGCTGCACAGGCCAGG - Intronic
1175771772 20:61628601-61628623 GGCCTCCAGCCCCACAGGCCGGG + Intronic
1176410677 21:6447970-6447992 CCACCACATCCCCACAGGCCAGG - Intergenic
1176771685 21:13080302-13080324 AGATCACAGGACCACAGGACCGG + Intergenic
1177173261 21:17677011-17677033 GAAGCACAGCACCACAGGGAGGG + Intergenic
1177248962 21:18567978-18568000 TGCCCCCAGCACCACAGGGCAGG - Intergenic
1177672089 21:24245749-24245771 GCACCACAGCACTCCAGCCCGGG - Intergenic
1177772488 21:25531949-25531971 GAAGCACAGCACCACAGGGAGGG + Intergenic
1178014550 21:28328989-28329011 AGATCACAGGACCACAGGACCGG + Intergenic
1178667309 21:34559850-34559872 GGACCACAGAATCACAGGGCAGG - Intronic
1179275972 21:39891942-39891964 GAAGCACAGCACCACAGGGAGGG + Intronic
1179537321 21:42060978-42061000 CGCCCACACCAGCACAGGCCAGG - Intergenic
1179677499 21:42993773-42993795 GCACCACTGCACTCCAGGCCAGG - Intronic
1179686171 21:43056292-43056314 CCACCACATCCCCACAGGCCAGG - Intronic
1179799290 21:43803414-43803436 GGATGCCAGCACCACAGACCTGG - Intronic
1179944647 21:44664854-44664876 GGGCCACAGCTCCAGAGGGCGGG + Intronic
1180123353 21:45768842-45768864 GGACGATAGCACTGCAGGCCAGG - Intronic
1180340943 22:11618121-11618143 GCACCACTGCACTACAGCCCGGG + Intergenic
1180708508 22:17824182-17824204 GACCCACAGGACCACTGGCCGGG + Intronic
1180837915 22:18940482-18940504 TGCCCCCAGCACCACAGGGCAGG + Intergenic
1180984305 22:19895446-19895468 GGAGGACAGCACCACCGGCAAGG - Exonic
1181307704 22:21926488-21926510 GGACCACAACACCCCAGGCCTGG + Intronic
1181813226 22:25418083-25418105 GCACCACTGCACCCCAGGCTGGG - Intergenic
1182139282 22:27938896-27938918 GCACCACTGCACTCCAGGCCAGG + Intergenic
1182166455 22:28179200-28179222 GCACCACTGCACTCCAGGCCTGG - Intronic
1182386058 22:29942386-29942408 AGATCACAGGACCACAGGACCGG + Intronic
1183075951 22:35426812-35426834 GGAACACAGCAGCAGAGGCTCGG - Intergenic
1183724495 22:39580962-39580984 GGACCGCAGTACACCAGGCCTGG + Intronic
1184190028 22:42888201-42888223 GGACCAAATCACCAGTGGCCTGG - Intronic
1184418461 22:44365379-44365401 GGGAAGCAGCACCACAGGCCAGG - Intergenic
1184546168 22:45169892-45169914 GAAGCACAGCACCACAGGGAGGG - Intronic
1184651428 22:45921012-45921034 GGACCACAGGGCCAGAGCCCAGG + Exonic
1184698652 22:46153814-46153836 GCACCACAGCACCCCAGCCTGGG + Intronic
1185206015 22:49539200-49539222 GTGACAAAGCACCACAGGCCGGG + Intronic
1185292497 22:50034241-50034263 GGCCCACAGCACCACAGGGAAGG - Intronic
1185305556 22:50113525-50113547 GGACCACCTCACCACAGGCAGGG - Intronic
949447404 3:4149769-4149791 GGACTACACGTCCACAGGCCAGG - Intronic
949531799 3:4963031-4963053 GCACCACTGCACCCCAGGCTGGG + Intergenic
950090743 3:10292475-10292497 GGACAGCAGAAGCACAGGCCGGG + Intronic
950464752 3:13146789-13146811 AGACCACAGCACTCCAGGCTGGG + Intergenic
951216117 3:20026918-20026940 GCACCACTGCACCACAGCCTAGG - Intergenic
952488213 3:33837629-33837651 GCACCACTGCACCACAGCCTGGG - Intronic
953519621 3:43628921-43628943 AGATCACAGGACCACAGGACTGG - Intronic
954210042 3:49091178-49091200 GCACCACAGCACTCCAGCCCGGG + Intronic
954219248 3:49142715-49142737 AGATCACAGGACCACAGGACTGG + Intergenic
954428661 3:50457549-50457571 GGACCAGAGCACCTGGGGCCAGG - Intronic
954691087 3:52395979-52396001 GCACCACTGCACCCCAGCCCCGG - Intronic
954704309 3:52471026-52471048 GGACCACAGCTCCTCAGACCTGG - Intronic
955962655 3:64356816-64356838 GGACCACAGCACTGCAAGGCTGG - Intronic
956790786 3:72678560-72678582 GAACCACAGGACCAAAGTCCAGG + Intergenic
957027439 3:75198825-75198847 GCACCACAGCACTACAGCCTGGG - Intergenic
957119432 3:76070539-76070561 AGATCACAGGACCACAGGACAGG - Intronic
957926582 3:86821944-86821966 AGATCACAGGACCACAGGACCGG + Intergenic
958603399 3:96327902-96327924 AGATCACAGGACCACAGGCCCGG - Intergenic
958998968 3:100939658-100939680 AGATCACAGAACCACAGGACCGG + Intronic
959126389 3:102294709-102294731 AGATCACAGGACCACAGGACCGG - Intronic
959470564 3:106744712-106744734 AGATCACAGGACCACAGGACCGG - Intergenic
959557031 3:107732093-107732115 GCAACACTGCACCCCAGGCCTGG - Intronic
959575282 3:107927038-107927060 GGACCACAGCACATCAGGATGGG - Intergenic
959705495 3:109335469-109335491 GGACCACTGCACTACAGCCGGGG - Intronic
959712340 3:109397530-109397552 GCACCACTGCACCACAGCCTGGG + Intergenic
959938956 3:112060225-112060247 AGATCACAGGACCACAGGACCGG + Intronic
960028164 3:113031613-113031635 TGCCCCCAGCACCACAGGGCAGG - Intergenic
960374231 3:116878716-116878738 AGATCACAGGACCACAGGACTGG + Intronic
960405333 3:117252839-117252861 GGACAGCAGCTCAACAGGCCAGG + Intergenic
960541296 3:118865311-118865333 AGATCACAGGACCACAGGACCGG - Intergenic
961296899 3:125892102-125892124 TGCCCCCAGCACCACAGGGCAGG + Intergenic
961554903 3:127690911-127690933 AGGCCACAGCAGGACAGGCCGGG - Exonic
961698178 3:128721124-128721146 AGATCACAGGACCACAGGACCGG - Intergenic
961837426 3:129674630-129674652 GGACTACAGAATCACAGGACAGG + Intronic
961923647 3:130452620-130452642 AGATCACAGGACCACAGGACTGG + Intronic
962290380 3:134131350-134131372 AGATCACAGGACCACAGGACCGG + Intronic
962651575 3:137499097-137499119 AGATCACAGGACCACAGGACTGG - Intergenic
962765307 3:138556845-138556867 AGATCACAGGACCACAGACCGGG + Intronic
963176553 3:142303909-142303931 AGATCACAGGACCACAGGACCGG + Intergenic
963326960 3:143873945-143873967 GAAGCACAGCACCACAGGGAGGG + Intergenic
963414940 3:144983394-144983416 AGATCACAGGACCACAGGACTGG + Intergenic
963696027 3:148566747-148566769 TGCCCCCAGCACCACAGGGCAGG - Intergenic
963957665 3:151273271-151273293 GCACCACTGCACCACAGCCTGGG - Intronic
964121783 3:153192750-153192772 CAACCACTGCACCCCAGGCCTGG - Intergenic
964353771 3:155830066-155830088 AGATCACAGCAATACAGGCCGGG + Intronic
964880394 3:161417106-161417128 AGATCACAGGACCACAGGACCGG + Intergenic
964945899 3:162223104-162223126 AGATCACAGGACCACAGGACCGG - Intergenic
965111377 3:164428454-164428476 GCACCACTGCACAACCGGCCAGG - Intergenic
966124876 3:176564070-176564092 AGATCACAGGACCACAGGACCGG - Intergenic
966142601 3:176772707-176772729 AGATCACAGGACCACAGGACCGG - Intergenic
966817354 3:183900175-183900197 AGATCACAGGACCACAGGACTGG - Intergenic
966962640 3:184955211-184955233 GAAGCACAGCACCACAGGGAGGG - Intronic
967026596 3:185569901-185569923 TGCCCCCAGCACCACAGGGCAGG - Intergenic
967077505 3:186017165-186017187 GCACCACTGCACTACAGCCCAGG + Intergenic
967412757 3:189183355-189183377 AGATCACAGCACCACAGGACCGG + Intronic
968367715 3:198199972-198199994 AGATCACAGGACCACAGGACTGG + Intergenic
968439454 4:615262-615284 GAACCACAGCACCACACAGCAGG - Intergenic
968481070 4:833350-833372 GGCCCACAGCTCCACAGGCCTGG + Intergenic
968574929 4:1361207-1361229 GGACCACAGCACCACAGGCCTGG - Intronic
968662593 4:1804966-1804988 GGCCCTCAGCACCACTGACCGGG - Exonic
968689758 4:1984430-1984452 GGCTCACAGCACCTCAGGCCAGG - Intronic
968996363 4:3948154-3948176 CTCCCACGGCACCACAGGCCTGG - Intergenic
969299130 4:6287212-6287234 GGCCCCCGGCACAACAGGCCTGG + Intronic
969514413 4:7638516-7638538 AGACCCCAGCCCCACAGACCAGG - Intronic
969817603 4:9698065-9698087 CTCCCACGGCACCACAGGCCTGG + Intergenic
970362125 4:15320713-15320735 GGACCATAGCATCACAGGGTGGG - Intergenic
971365845 4:25976576-25976598 AGATCACAGGACCACAGGACCGG - Intergenic
971571833 4:28222414-28222436 GAACCACAACACCTCATGCCAGG + Intergenic
971586311 4:28409089-28409111 AGATCACAGGACCACAGGACTGG + Intergenic
971874597 4:32290629-32290651 GAACCACAGCACTACAGCCTGGG - Intergenic
972038206 4:34554012-34554034 AGATCACAGGACCACAGGACTGG + Intergenic
972202963 4:36737395-36737417 GCACCACCGCACTACAGGCTGGG + Intergenic
972610277 4:40649979-40650001 TGAAAACAGCACCACAGGCTCGG - Intergenic
973262215 4:48176677-48176699 GGGCCACTGTACCTCAGGCCTGG + Intronic
973266818 4:48219432-48219454 GAAGCACAGCACCACAGGGAGGG - Intronic
973960916 4:56108919-56108941 GAAGCACAGCACCACAGGGAGGG + Intergenic
974208834 4:58743246-58743268 AGATCACAGGACCACAGGACCGG + Intergenic
974472649 4:62338249-62338271 AGATCACAGGACCACAGGACCGG + Intergenic
974983340 4:68989411-68989433 AGATCACAGGACCACAGGACTGG - Intergenic
975024921 4:69535815-69535837 AGATCACAGGACCACAGGACCGG - Intergenic
975464388 4:74693051-74693073 GGCCCACTGCACCAGATGCCAGG + Intergenic
976254434 4:83085226-83085248 GAAGCACAGCACCACAGGGAGGG - Intergenic
976275944 4:83277924-83277946 GCACCACTGCACTCCAGGCCTGG + Intronic
976375387 4:84339847-84339869 AGATCACAGGACCACAGGACCGG + Intergenic
976816326 4:89151525-89151547 AGATCACAGGACCACAGGACCGG - Intergenic
977605777 4:98984021-98984043 AGATCACAGAACCACAGGACCGG + Intergenic
978211997 4:106148182-106148204 AGATCACAGGACCACAGGACTGG - Intronic
979162100 4:117474302-117474324 GCACCACTGCACTACAGCCCAGG + Intergenic
979256133 4:118609683-118609705 AGATCACAGGACCACAGGACCGG + Intergenic
979332214 4:119430854-119430876 AGATCACAGGACCACAGGACCGG - Intergenic
979675924 4:123410327-123410349 GCACCACAGCACTCCAGCCCTGG - Intergenic
979678288 4:123433347-123433369 AGATCACAGGACCACAGGACCGG - Intergenic
981421122 4:144551381-144551403 AGATCACAGGACCACAGGACCGG + Intergenic
982179681 4:152738273-152738295 GTACCACTGCACCATAGGCAGGG - Intronic
982395108 4:154907758-154907780 GAAGCACAGCACCACAGGGAGGG + Intergenic
982807891 4:159789254-159789276 AGATCACAGGACCACAGGACTGG - Intergenic
982876760 4:160660427-160660449 TGCCCCCAGCACCACAGGGCAGG + Intergenic
983301651 4:165933721-165933743 GGACCACACCACCTCAGAGCAGG + Intronic
983894154 4:173063721-173063743 AGATCACAGGACCACAGGACTGG + Intergenic
984064241 4:175028391-175028413 AGATCACAGGACCACAGGACTGG + Intergenic
985025686 4:185737267-185737289 GAACCGCAGCAGCCCAGGCCTGG + Intronic
986231845 5:5871877-5871899 TGACCTCAGCATCACAGGCTGGG + Intergenic
986338587 5:6772314-6772336 GGAACAAAGCACCACAGACTGGG + Intergenic
986721281 5:10563348-10563370 GGCCCACAGCCCCTCTGGCCCGG - Intergenic
987138147 5:14918762-14918784 GGAAGACAGCACCAAAGCCCAGG - Intergenic
987246105 5:16050347-16050369 GGGCCACTGCACTCCAGGCCAGG + Intergenic
987583255 5:19822715-19822737 AGATCACAGGACCACAGGACTGG + Intronic
987626093 5:20402863-20402885 GCACCACTGCACCCCAGGCTGGG + Intronic
987826420 5:23035676-23035698 GGACCACAGTTCCACATGGCTGG + Intergenic
988573944 5:32400809-32400831 GCACCACTGCACTCCAGGCCTGG + Intronic
989384090 5:40837409-40837431 GCACCACTGCACTCCAGGCCAGG - Intergenic
989392722 5:40919164-40919186 AGACCACTGCACTACAGGCTGGG - Intronic
989455078 5:41634749-41634771 AGATCACAGGACCACAGGACTGG - Intergenic
989572262 5:42955558-42955580 AGATCACAGGACCACAGGACCGG + Intergenic
989772494 5:45161419-45161441 TGACCACAGTACCACATGCAAGG - Intergenic
990402725 5:55455576-55455598 GTACCACTGCACTCCAGGCCAGG + Intronic
990433700 5:55765845-55765867 GTACCACTGCACTCCAGGCCAGG - Intronic
991622990 5:68565616-68565638 GGACCATAACTCCACTGGCCTGG + Intergenic
991626046 5:68602023-68602045 AGATCACAGGACCACAGGACTGG - Intergenic
992955201 5:81901291-81901313 AGATCACAGGACCACAGGACCGG - Intergenic
994734360 5:103533918-103533940 AGATCACAGGACCACAGGACCGG - Intergenic
994756473 5:103799519-103799541 GCACCACAGCACTCCAGCCCTGG - Intergenic
994890117 5:105622887-105622909 GCACCACAGCACCCCAGCCTGGG - Intergenic
995593943 5:113729017-113729039 AGATCACAGGACCACAGGACCGG + Intergenic
996100093 5:119436977-119436999 AGATCACAGGACCACAGGACCGG - Intergenic
997089776 5:130843308-130843330 AGATCACAGGACCACAGGACCGG - Intergenic
997244808 5:132338364-132338386 AGATCACAGGACCACAGGACCGG + Intronic
997804079 5:136897041-136897063 GGGCCACAGCACAACAGCCTCGG - Intergenic
997920794 5:137977309-137977331 AGATCACAGGACCACAGGACTGG - Intronic
998266918 5:140673438-140673460 GGACCCCAGTACCACAGGAGAGG - Exonic
998940038 5:147271864-147271886 AGATCACAGGACCACAGGACTGG - Intronic
999093212 5:148955617-148955639 AGATCACAGGACCACAGGACTGG + Intronic
999325105 5:150638957-150638979 GGATCACAGGATCACAGCCCAGG - Intronic
999819308 5:155209649-155209671 GCACCACAGCACTCCAGGCCGGG - Intergenic
999952428 5:156665055-156665077 TGCCCCCAGCACCACAGGGCAGG - Intronic
1000562673 5:162810166-162810188 AGATCACAGGACCACAGGACCGG - Intergenic
1000615281 5:163419277-163419299 AGATCACAGGACCACAGGACCGG - Intergenic
1001330127 5:170755975-170755997 GGACCCCAGCACCACAGATTCGG - Intergenic
1001342383 5:170859813-170859835 GCACCACTGCACTCCAGGCCAGG - Intergenic
1001559096 5:172657805-172657827 GAAGCACAGCACCACAGGGAGGG - Intronic
1001564181 5:172688882-172688904 TGTCTGCAGCACCACAGGCCTGG - Exonic
1002332399 5:178453431-178453453 TTACAACAGCACCACAGGCACGG - Intronic
1002354085 5:178609864-178609886 GCACCACTGCACTCCAGGCCAGG + Intronic
1002447452 5:179298064-179298086 TTTCCACAGCACCAGAGGCCAGG + Intronic
1002726935 5:181305201-181305223 AGATCACAGGACCACAGGACCGG + Intergenic
1002948621 6:1786507-1786529 GGACCTCAGCATCCCAGGCTGGG + Intronic
1003177442 6:3762523-3762545 GCACCACAGCACTCCAGCCCGGG - Intergenic
1003308273 6:4947586-4947608 GGACCACCCCCCAACAGGCCAGG - Intronic
1003591032 6:7436974-7436996 AGAACACAGCACCATAGGCCGGG - Intergenic
1003631851 6:7794555-7794577 GTACCACAGCACTCCAGGCTGGG + Intronic
1003931395 6:10927631-10927653 AGATCACAGGACCACAGGACCGG + Intronic
1004148681 6:13093912-13093934 GCACCACTGCACCCCAGCCCGGG - Intronic
1004471288 6:15931696-15931718 AGATCACAGGACCACAGGACCGG + Intergenic
1004778268 6:18873440-18873462 AGATCACAGGACCACAGGACCGG - Intergenic
1005161150 6:22865588-22865610 GTACCACAGGACCATAGGCCGGG + Intergenic
1005623274 6:27639460-27639482 GGACCACTGCACCCCAGCCTGGG + Intergenic
1005864968 6:29930403-29930425 GAAGCACAGCACCACAGGGAGGG + Intergenic
1005971428 6:30764832-30764854 GGATCACAGGACCACAGGACCGG + Intergenic
1006368717 6:33631614-33631636 GAAGCACAGCACCACAGGGAAGG + Intronic
1006418045 6:33916570-33916592 AGATCACAGGACCACAGGACCGG + Intergenic
1006842596 6:37039309-37039331 GCACCACTGCACCACAGCCTGGG + Intergenic
1007057146 6:38897736-38897758 GGACCACTGCACTCCAGTCCGGG + Intronic
1007419966 6:41713381-41713403 TGACCACAGCATCCCAGCCCAGG + Intronic
1007551628 6:42734240-42734262 GAAGCACAGCACCACAGGGAGGG + Intergenic
1008100503 6:47385470-47385492 AGATCACAGGACCACAGGACTGG - Intergenic
1008170740 6:48202516-48202538 AGATCACAGGACCACAGGACGGG - Intergenic
1008891192 6:56492822-56492844 AGATCACACCACCACAGTCCTGG + Intronic
1008909685 6:56719927-56719949 AGATCACAGGACCACAGGACTGG + Intronic
1010102967 6:72131618-72131640 AGATCACAGGACCACAGGACTGG + Intronic
1010139205 6:72594401-72594423 GCACCACTGCACCACAGCCTGGG - Intergenic
1010592215 6:77724544-77724566 TGCCCCCAGCACCACAGGGCAGG - Intronic
1011746407 6:90411701-90411723 GTGCCTCAGCACCACAAGCCAGG - Intergenic
1011878432 6:91992138-91992160 AGATCACAGGACCACAGGACTGG + Intergenic
1012122641 6:95386714-95386736 AGATCACAGGACCACAGGACCGG + Intergenic
1012689108 6:102292290-102292312 GGCCCACTGCTCAACAGGCCAGG - Intergenic
1012960330 6:105615373-105615395 AGATCACAGGACCACAGGACCGG + Intergenic
1013374840 6:109504319-109504341 GTACCACTGCACCCCAGCCCGGG + Intronic
1014137475 6:117906933-117906955 GGAATCCAGCACCACCGGCCTGG - Intergenic
1014319339 6:119907329-119907351 AGATCACAGGACCACAGGACTGG - Intergenic
1014506713 6:122268584-122268606 TGACCACAGCACCACAAAACTGG + Intergenic
1014852355 6:126357649-126357671 GCACCACTGCACTACAGGCTGGG - Intergenic
1015180816 6:130360583-130360605 AGAACACAGGACCACAGGACCGG + Intronic
1016222381 6:141691177-141691199 GTGCCACTGCACCACCGGCCTGG - Intergenic
1016586789 6:145697382-145697404 AGATCACAGGACCACAGGACCGG + Intronic
1017261066 6:152388286-152388308 GCACCACAGCACTACAGCCTTGG - Intronic
1017547844 6:155470542-155470564 GGACCACAGATCCAGAGTCCAGG + Intergenic
1017708963 6:157148736-157148758 GGGGCACAGCACCACATGGCTGG - Exonic
1018116354 6:160589683-160589705 GGAGCAAAGCCCCACAGTCCAGG - Exonic
1018921943 6:168181506-168181528 GGAGCCCAGGAGCACAGGCCTGG - Intergenic
1018985191 6:168630987-168631009 AGATCACAGGACCACAGGCCCGG - Intronic
1019233014 6:170584543-170584565 GAAGCCCAGCTCCACAGGCCTGG + Exonic
1019348567 7:542546-542568 GGGCCGCAGCATCCCAGGCCGGG + Intergenic
1019382345 7:730618-730640 GGACCCCAGCAGCACAGACGAGG - Intronic
1019413771 7:918257-918279 GCACCACTGCACTCCAGGCCGGG - Intronic
1019415036 7:923187-923209 GGAACACAGCACCACATGCCCGG - Intronic
1019976889 7:4590067-4590089 TGCCCCCAGCACCACAGGGCAGG - Intergenic
1019977824 7:4598570-4598592 TGCCCCCAGCACCACAGGGCAGG - Intergenic
1020048455 7:5062512-5062534 AGATCACAGGACCACAGGACCGG + Intronic
1020387738 7:7626290-7626312 AGATCACAGGACCACAGGACCGG + Intergenic
1020803487 7:12760357-12760379 AGATCACAGGACCACAGGACCGG + Intergenic
1021722951 7:23521481-23521503 GCACCACTGCACCACAGCCTGGG - Intronic
1021807772 7:24374041-24374063 GCGCCACTGCACTACAGGCCTGG - Intergenic
1021983906 7:26080939-26080961 GTACCACTGCACTCCAGGCCGGG + Intergenic
1022472082 7:30688327-30688349 GGAACAAAGCACCACAGACTGGG - Intronic
1022478150 7:30725383-30725405 GTAACAAAGCACCACAGACCAGG - Intronic
1023565910 7:41523473-41523495 AGATCACAGGACCACAGGACTGG + Intergenic
1023788725 7:43735055-43735077 GAAACACAGCACCACAGGGAGGG + Intergenic
1024174069 7:46820247-46820269 GAAGCACAGCACCACAGGGAGGG + Intergenic
1024403005 7:48946583-48946605 AGACCACAGGACCACAGGACCGG + Intergenic
1024456551 7:49614951-49614973 GAAGCACAGCACCACAGGGAGGG - Intergenic
1024586441 7:50845886-50845908 AGATCACAGGACCACAGGACCGG - Intergenic
1025155231 7:56599224-56599246 AGATCACAGGACCACAGGACTGG + Intergenic
1025600133 7:62986551-62986573 AGATCACAGGACCACAGGACTGG + Intergenic
1025734778 7:64137328-64137350 AGATCACAGGACCACAGGACTGG - Intronic
1025749475 7:64280878-64280900 AGATCACAGGACCACAGGACCGG + Intergenic
1026098574 7:67366364-67366386 GCACCACAGCACCCCAGCCTGGG + Intergenic
1026937308 7:74265381-74265403 GGACCACTGCACCCCAGGCTGGG - Intergenic
1027226381 7:76246519-76246541 GCACCACTGCACTCCAGGCCAGG + Intronic
1027628814 7:80576843-80576865 AGATCACAGGACCACAGGACTGG - Intronic
1027793221 7:82658756-82658778 AGATCACAGGACCACAGGACTGG + Intergenic
1028007493 7:85593474-85593496 GGGCCCCAGCACCACAGACAAGG - Intergenic
1028017269 7:85731694-85731716 AGATCACAGGACCACAGGACCGG - Intergenic
1028196613 7:87914508-87914530 GCACCACAGCACTCCAGCCCAGG - Intergenic
1028400881 7:90424185-90424207 AGATCACAGGACCACAGGACCGG - Intronic
1028539365 7:91925286-91925308 AGATCACAGGACCACAGGACCGG + Intergenic
1029524955 7:101088654-101088676 GGACCCCAGCCCCACAGGGGTGG + Exonic
1029709524 7:102292034-102292056 GGACCTTAGCAGCACTGGCCTGG - Intronic
1029967173 7:104751960-104751982 TGCCCCCAGCACCACAGGGCAGG - Intronic
1030100861 7:105944126-105944148 GCACCACAGCACTCCAGGTCTGG + Intronic
1030139350 7:106289122-106289144 GGACCACAGCACTCCAGCCTGGG - Intergenic
1030601439 7:111597408-111597430 AGATCACAGGACCACAGGACTGG - Intergenic
1031309213 7:120173232-120173254 GCACCACTGCACCACAGCCTGGG + Intergenic
1031427003 7:121617263-121617285 AGATCACAGGACCACAGGACTGG - Intergenic
1031838258 7:126704865-126704887 AGATCACAGGACCACAGGACAGG - Intronic
1031930456 7:127680243-127680265 AGATCACAGGACCACAGGACTGG + Intronic
1033426923 7:141253056-141253078 GGAGCATAGCACCACAGAACTGG - Intronic
1033859469 7:145607071-145607093 AGATCACAGGACCACAGGACTGG - Intergenic
1034093115 7:148382203-148382225 TGCTCACAGCCCCACAGGCCTGG + Intronic
1034147912 7:148888513-148888535 GGACCACAGCACTCCAGCCTGGG + Intergenic
1034674483 7:152882755-152882777 CGGCCACAGCCCCAGAGGCCGGG - Intergenic
1034906138 7:154948503-154948525 GCACCACAGCACCCCAGCCTGGG + Intronic
1035027432 7:155835212-155835234 GGACCACAGGTGCACACGCCAGG + Intergenic
1035432813 7:158835028-158835050 GAAGCACAGCACCACAGGGAGGG - Intergenic
1035686871 8:1530005-1530027 AGATCACAGGACCACAGGACGGG + Intronic
1036021190 8:4848580-4848602 GTGCCACAGCACCGCAGGCCTGG - Intronic
1036292432 8:7505515-7505537 TGCCCCCAGCACCACAGGGCAGG - Intronic
1036705445 8:11042999-11043021 GCACTACAGCAGCACAAGCCTGG - Intronic
1036999274 8:13698358-13698380 AGATCACAGGACCACAGGCCCGG + Intergenic
1037025278 8:14028081-14028103 GAAGCACAGCACCACAGGGAGGG + Intergenic
1037482240 8:19315176-19315198 GCACCACTGCACCACAGCCTGGG - Intronic
1037725281 8:21478270-21478292 GGCACACAGCACCTCAGCCCTGG - Intergenic
1038314648 8:26473684-26473706 GGACCACTGCACTCCAGCCCGGG - Intronic
1039552427 8:38452679-38452701 GGACAACAGCAGCATTGGCCAGG + Intronic
1039923159 8:41907033-41907055 GGACTACAGCAGCTCAGGTCGGG + Intergenic
1040393077 8:46966522-46966544 AGATCACAGGACCACAGGACCGG + Intergenic
1040507060 8:48058424-48058446 GGCGCACACCACCACAGGCCCGG - Intronic
1040634338 8:49254754-49254776 AGATCACAGGACCACAGGACCGG - Intergenic
1040973055 8:53158521-53158543 GCACCACTGCACCCCAGCCCGGG - Intergenic
1041559674 8:59201788-59201810 AGATCACAGGACCACAGGACCGG + Intergenic
1041584136 8:59496169-59496191 AGATCACAGGACCACAGGACTGG + Intergenic
1041596922 8:59665883-59665905 GAAGCACAGCACCACAGGGAGGG - Intergenic
1041650203 8:60294721-60294743 GAAGCACAGCACCACAGGGAGGG - Intergenic
1041664899 8:60433782-60433804 AGATCACAGGACCACAGGACTGG + Intergenic
1041824150 8:62072960-62072982 AGATCACAGGACCACAGGACTGG + Intergenic
1042239598 8:66649464-66649486 GCACCACAGCACTCCAGCCCAGG + Intronic
1042529248 8:69797833-69797855 AGATCACAGGACCACAGGACCGG - Intronic
1042733961 8:71967127-71967149 GGACCACAGCACAAGAGGTTGGG - Intronic
1042933918 8:74039839-74039861 GAAGCACAGCACCACAGGATGGG + Intergenic
1043055578 8:75433362-75433384 GGGCCACAGCACCACAGCCTGGG + Intronic
1043327482 8:79070430-79070452 AGATCACAGGACCACAGGACCGG - Intergenic
1043684767 8:83071527-83071549 AGACCACAGGACCACAGGACTGG + Intergenic
1043977520 8:86599826-86599848 AGATCACAGGACCACAGGACTGG - Intronic
1045128019 8:99116068-99116090 GCACCACAGCACTCCAGCCCAGG - Intronic
1045841079 8:106581979-106582001 GCACCACTGCACCACAGCCTGGG + Intronic
1046413863 8:113884638-113884660 GAAGCACAGCACCACAGGGAGGG + Intergenic
1046864517 8:119131265-119131287 GGACCACTGCACTACAGCCCAGG - Intergenic
1047265576 8:123304959-123304981 GGACCACTGCACTCCAGCCCGGG - Intergenic
1047447631 8:124933704-124933726 AGATCACAGGACCACAGGACCGG - Intergenic
1047489808 8:125365185-125365207 GCAGCACAGAACCACAGTCCTGG - Intronic
1047521073 8:125595865-125595887 GGACCACAGCAGAACAGGTGGGG + Intergenic
1048002931 8:130394503-130394525 AGATCACAGGACCACAGGACCGG - Intronic
1048240502 8:132736786-132736808 GGACCACTGCACCCCAGCCTGGG + Intronic
1048776668 8:137954274-137954296 GGCTCACAGCTCCACAGGGCTGG + Intergenic
1048820272 8:138373951-138373973 AGATCACAGGACCACAGGACAGG - Intronic
1048947397 8:139462131-139462153 TGCCCCCAGCACCACAGGGCAGG - Intergenic
1048986698 8:139738636-139738658 GGACCCCAGAACCACACGGCGGG + Intronic
1049241650 8:141540412-141540434 GGTACAAAGCACCACAGGCTGGG + Intergenic
1049415865 8:142494817-142494839 GGCCCTCAGCACTACAAGCCAGG - Intronic
1049553431 8:143271040-143271062 AGTCCCCAGCCCCACAGGCCTGG + Intronic
1049588273 8:143441754-143441776 GGCGCCCTGCACCACAGGCCAGG - Intronic
1050606421 9:7305965-7305987 GAACCACAGCAGCACAGGAAAGG - Intergenic
1051549891 9:18316201-18316223 AGATCACAGGACCACAGGACCGG + Intergenic
1052009472 9:23389003-23389025 AGATCACAGGACCACAGGACCGG + Intergenic
1052044066 9:23774166-23774188 GCACCACTGCACCCCAAGCCTGG + Intronic
1052083791 9:24239150-24239172 AGATCACAGGACCACAGGACTGG + Intergenic
1052426444 9:28311270-28311292 AGATCACAGGACCACAGGACCGG + Intronic
1052942530 9:34141585-34141607 GCACCACCGCACTCCAGGCCAGG + Intergenic
1054978025 9:71171240-71171262 AGATCACAGGACCACAGGACTGG - Intronic
1055438888 9:76319740-76319762 GAAGCACAGCACCACAGGGAGGG - Intronic
1055526687 9:77140843-77140865 GCACCACTGCACCACAGCCTGGG + Intergenic
1055784864 9:79861971-79861993 AGATCACAGGACCACAGGACCGG - Intergenic
1055908030 9:81316254-81316276 AGATCACAGGACCACAGGCCCGG + Intergenic
1057538793 9:95944933-95944955 AGATCACAGGACCACAGGACCGG + Intronic
1057696222 9:97324677-97324699 AGGCCACAGCAACACTGGCCTGG - Intronic
1057715680 9:97493506-97493528 AGATCACAGGACCACAGGACCGG + Intronic
1057716964 9:97502616-97502638 GGACCCCAGCGTCCCAGGCCCGG - Intronic
1057782638 9:98062161-98062183 GGACCACAGCACTCCAGCCTGGG + Intronic
1058294925 9:103294508-103294530 GAAGCACAGCACCACAGGGAGGG + Intergenic
1059038690 9:110788587-110788609 GCACCACTGCACCACAGCCTGGG + Intronic
1059281857 9:113141306-113141328 AGATCACAGGACCACAGGACCGG - Intergenic
1060393867 9:123302056-123302078 GCACCACTGCACGACAGCCCGGG - Intergenic
1060519862 9:124288121-124288143 GGTCCACAGGCCCAAAGGCCTGG + Intronic
1060618072 9:125037224-125037246 GCACCACTGCACTCCAGGCCTGG + Intronic
1060877435 9:127093451-127093473 CCACCACAGCCCCACAGGACAGG - Intronic
1061061270 9:128251454-128251476 GGCCCACAGGAGCAGAGGCCAGG + Intronic
1061215114 9:129217313-129217335 GGAACTCAGCCCCTCAGGCCTGG + Intergenic
1061458483 9:130716791-130716813 GCACCACAGCACTCCAGCCCGGG - Intronic
1061548568 9:131319062-131319084 GCACCACTGCACTACAGGCTGGG - Intergenic
1061946587 9:133911869-133911891 GGCCCAGAGCCCCACAGGTCAGG + Intronic
1062448849 9:136607147-136607169 GCCCCACCGCACCCCAGGCCCGG - Intergenic
1062506398 9:136879660-136879682 GCACCACAGCACCCCAGCCTGGG - Intronic
1062665938 9:137671866-137671888 GGACCACAGCACTGCAGGGTTGG - Intronic
1062732898 9:138119495-138119517 GATCCACAGCTCCACAGCCCAGG - Intronic
1062752056 9:138262677-138262699 AGATCACAGGACCACAGGACTGG + Intergenic
1185659049 X:1712146-1712168 GGGCCACAGCACTACAGCCTGGG - Intergenic
1185787022 X:2899363-2899385 GTACCACAGCACCCCAGCCTGGG + Intergenic
1185880915 X:3740111-3740133 GCACCACTGCACCCCAGGCCTGG + Intergenic
1186329166 X:8513989-8514011 AGATCACAGGACCACAGGACGGG - Intergenic
1186843346 X:13507088-13507110 GCACCACTGCACTCCAGGCCTGG - Intergenic
1187071385 X:15892243-15892265 GCACCACTGCACTACAGCCCAGG + Intergenic
1187414736 X:19083407-19083429 GGACCACCCCACCCCAGGTCTGG - Intronic
1187473562 X:19590064-19590086 GCACCACTGCACCCCAGGCTGGG + Intronic
1187845053 X:23525977-23525999 GAACCACAGCAACACAGGGCTGG + Intergenic
1188849544 X:35114864-35114886 AGATCACAGGACCACAGGACTGG - Intergenic
1188979400 X:36713567-36713589 AGATCACAGGACCACAGGACCGG + Intergenic
1190002026 X:46698131-46698153 AGATCACAGGACCACAGGACCGG - Intronic
1190044004 X:47097788-47097810 GTGCCACTGCACTACAGGCCTGG - Intergenic
1190128116 X:47723770-47723792 GGAGGACAGGACCAGAGGCCCGG - Intergenic
1190365358 X:49688357-49688379 GCACCACAGCACCCCAGTCTGGG + Intronic
1190511474 X:51177757-51177779 GAAGCACAGCACCACAGGGAGGG + Intergenic
1190616319 X:52236686-52236708 AGATCACAGGACCACAGGACTGG - Intergenic
1191148417 X:57193414-57193436 AGATCACAGGACCACAGGACAGG - Intergenic
1191244856 X:58219175-58219197 AGATCACAGGACCACAGGACAGG + Intergenic
1191980876 X:66924129-66924151 AGATCACAGGACCACAGGACCGG - Intergenic
1192752203 X:74005040-74005062 AGATCACAGGACCACAGGACTGG + Intergenic
1193238928 X:79143352-79143374 GGACCACTGCACCTCAGCCTGGG + Intergenic
1193301736 X:79897069-79897091 AGATCACAGGACCACAGGACTGG - Intergenic
1193594765 X:83432745-83432767 AGATCACAGGACCACAGGACCGG - Intergenic
1194101997 X:89717387-89717409 AGATCACAGGACCACAGGACTGG - Intergenic
1194535940 X:95106012-95106034 AGATCACAGGACCACAGGACTGG - Intergenic
1194699043 X:97091324-97091346 GGACCACTGCACTCCAGGCTAGG - Intronic
1194800795 X:98269853-98269875 GGACCACAGGACCACAGGACCGG - Intergenic
1196076714 X:111585895-111585917 AGACCATAGCACCATATGCCAGG - Intergenic
1197364704 X:125549357-125549379 AGATCACAGGACCACAGGACAGG + Intergenic
1197464712 X:126788868-126788890 GCACCACTGCACTACAGCCCTGG - Intergenic
1197473968 X:126897040-126897062 AGATCACAGGACCACAGGACTGG + Intergenic
1198023196 X:132679529-132679551 AGATCACAGGACCACAGGACTGG + Intronic
1199321293 X:146442335-146442357 AGATCACAGGACCACAGGACTGG - Intergenic
1199476989 X:148256829-148256851 AGATCACAGGACCACAGGACCGG + Intergenic
1199536438 X:148907694-148907716 AGATCACAGGACCACAGGACCGG + Intronic
1199671078 X:150148822-150148844 GGGCCACAGCACCACAGTGGTGG - Intergenic
1199884214 X:152003076-152003098 AGATCACAGGACCACAGGACTGG - Intergenic
1200753426 Y:6967892-6967914 GTAACAGAGCACCACGGGCCTGG + Intronic
1200848942 Y:7862596-7862618 GCACCACTGCACTCCAGGCCAGG + Intergenic
1200950479 Y:8893998-8894020 AGATCACAGGACCACAGGACTGG - Intergenic
1200978689 Y:9240999-9241021 AGATCACAGGACCACAGGACTGG - Intergenic
1201051422 Y:9939859-9939881 GCACCACTGCACTACAGGCTGGG + Intergenic
1201255958 Y:12108352-12108374 GCACCACTGCACCACAGCTCGGG + Intergenic
1201322469 Y:12715359-12715381 GCACCACTGCACCACAGCCTGGG - Intronic
1202132705 Y:21628323-21628345 AGATCACAGGACCACAGGACTGG + Intergenic
1202242325 Y:22784019-22784041 GAACCACTGCACTACAGCCCGGG - Intergenic
1202368438 Y:24182313-24182335 GGACCACAGGAGTAGAGGCCAGG - Intergenic
1202395311 Y:24417768-24417790 GAACCACTGCACTACAGCCCGGG - Intergenic
1202475474 Y:25252324-25252346 GAACCACTGCACTACAGCCCGGG + Intergenic
1202502347 Y:25487804-25487826 GGACCACAGGAGTAGAGGCCAGG + Intergenic