ID: 968575900

View in Genome Browser
Species Human (GRCh38)
Location 4:1366008-1366030
Sequence TGTGACGCCATTCCACAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 104}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968575887_968575900 13 Left 968575887 4:1365972-1365994 CCCTAAGCCCCGGGGGCACCGCC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 968575900 4:1366008-1366030 TGTGACGCCATTCCACAGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 104
968575886_968575900 14 Left 968575886 4:1365971-1365993 CCCCTAAGCCCCGGGGGCACCGC 0: 1
1: 0
2: 1
3: 3
4: 103
Right 968575900 4:1366008-1366030 TGTGACGCCATTCCACAGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 104
968575894_968575900 -8 Left 968575894 4:1365993-1366015 CCGCCCTCGCACCGGTGTGACGC 0: 1
1: 0
2: 0
3: 3
4: 36
Right 968575900 4:1366008-1366030 TGTGACGCCATTCCACAGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 104
968575891_968575900 4 Left 968575891 4:1365981-1366003 CCGGGGGCACCGCCGCCCTCGCA 0: 1
1: 0
2: 2
3: 16
4: 194
Right 968575900 4:1366008-1366030 TGTGACGCCATTCCACAGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 104
968575890_968575900 5 Left 968575890 4:1365980-1366002 CCCGGGGGCACCGCCGCCCTCGC 0: 1
1: 0
2: 2
3: 25
4: 284
Right 968575900 4:1366008-1366030 TGTGACGCCATTCCACAGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 104
968575889_968575900 6 Left 968575889 4:1365979-1366001 CCCCGGGGGCACCGCCGCCCTCG 0: 1
1: 0
2: 0
3: 22
4: 241
Right 968575900 4:1366008-1366030 TGTGACGCCATTCCACAGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 104
968575888_968575900 12 Left 968575888 4:1365973-1365995 CCTAAGCCCCGGGGGCACCGCCG 0: 1
1: 1
2: 0
3: 8
4: 124
Right 968575900 4:1366008-1366030 TGTGACGCCATTCCACAGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 104
968575893_968575900 -5 Left 968575893 4:1365990-1366012 CCGCCGCCCTCGCACCGGTGTGA 0: 1
1: 0
2: 0
3: 2
4: 60
Right 968575900 4:1366008-1366030 TGTGACGCCATTCCACAGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968575900 Original CRISPR TGTGACGCCATTCCACAGGA GGG Intronic
902464273 1:16605837-16605859 TGTCACATCATTCCACAGTAGGG + Intronic
903572266 1:24314877-24314899 TGTGACCCCATTTTACAGGTAGG + Intergenic
904351092 1:29907209-29907231 TGTCACGTCATTCCACTGCATGG + Intergenic
904923604 1:34028551-34028573 AGTGACTCCATTTCACAGGCAGG - Intronic
905318902 1:37101677-37101699 TGTCACGCCACTTCACAGGGAGG - Intergenic
906160157 1:43642210-43642232 TGTCACTCCATTCCCCAGGCTGG + Intergenic
907784529 1:57598744-57598766 TGTCACCCCAGTCCACATGAGGG + Intronic
909481833 1:76134475-76134497 TGTGACACCCCTCCACAGCATGG - Intronic
915447892 1:155984544-155984566 TGTGACGCTATTCCTGAGGGCGG + Intronic
921173504 1:212570694-212570716 TGTGACTCCATTCCATATAAAGG - Intronic
923542460 1:234898364-234898386 TGTAACGCCATTCAAATGGAAGG - Intergenic
1063529651 10:6819166-6819188 GGTGACCCAATCCCACAGGATGG - Intergenic
1065311269 10:24417784-24417806 TGGGATTCCATTTCACAGGACGG - Intronic
1065434737 10:25694770-25694792 TGTGACTCCTATCCACAGGAAGG + Intergenic
1070299078 10:75189705-75189727 CGGGAAGCCAGTCCACAGGATGG - Intergenic
1075426759 10:122347688-122347710 TGAGGCTGCATTCCACAGGAGGG - Intergenic
1080324413 11:31053425-31053447 TTTGACACTATTCCACAAGATGG + Intronic
1083156176 11:60824556-60824578 TGTGGGGCCTTTCCACAGGATGG + Intergenic
1083862002 11:65425321-65425343 TGTGATGCCATCTCACAGGCAGG + Intergenic
1087164510 11:94988023-94988045 TGTGAGGCAATTTCACAGCAAGG + Intronic
1091184767 11:133637428-133637450 TGTGAGGCCGTCCCTCAGGAAGG + Intergenic
1092494704 12:8980949-8980971 TGTAACCCCATTCCCCAGGCTGG - Intronic
1096341780 12:50806960-50806982 TGGGACGACAGTCCACAGAAAGG + Intronic
1101597598 12:106180722-106180744 TCTGTGTCCATTCCACAGGAAGG - Intergenic
1103551881 12:121743931-121743953 AGTGACACCAATCCAGAGGAAGG - Intronic
1106127150 13:26909864-26909886 TTTGAAGCCATTCCACAGTTTGG + Intergenic
1108741277 13:53341304-53341326 TGAGGCTGCATTCCACAGGAGGG - Intergenic
1108825852 13:54411391-54411413 TTTGACACTATTCCACAAGATGG + Intergenic
1108914172 13:55587919-55587941 TGTGGCACCATTCCTCAGGGTGG - Intergenic
1109136364 13:58656504-58656526 TGTGACCCCATGCCCCAGAAAGG + Intergenic
1111595428 13:90404453-90404475 GGTGGCTCCTTTCCACAGGAAGG - Intergenic
1118164093 14:63318782-63318804 TGTAACCTCATTCCAGAGGAGGG - Intronic
1122813379 14:104300105-104300127 TGTGGGGCCACTCCACAGGCAGG + Intergenic
1123085977 14:105717803-105717825 TCTGAGGCCAGGCCACAGGACGG - Intergenic
1124492014 15:30163943-30163965 TGTGACAAGATGCCACAGGAGGG - Intergenic
1124751523 15:32374374-32374396 TGTGACAAGATGCCACAGGAGGG + Intergenic
1127806096 15:62521889-62521911 TGTGACGCTATACCACAGTCAGG + Intronic
1129245574 15:74276852-74276874 TCTGACCCCATTCCTCAGGGAGG - Intronic
1131159276 15:90094017-90094039 TCTGACCCTATTCAACAGGAAGG + Intronic
1134007486 16:10827949-10827971 TGTGACCCCAGTGGACAGGATGG + Intergenic
1135342057 16:21657354-21657376 TGTGTCACCATTCCACTAGATGG + Exonic
1138600278 16:58049917-58049939 TGTGACCCCATCCCACAGGCAGG - Intergenic
1141931598 16:87208259-87208281 GGTGACGCCCTTCCACATCAGGG - Intronic
1144591539 17:16528392-16528414 GGTGACGCCATCCCATAGGCAGG + Intergenic
1148785240 17:50143069-50143091 TGTGAAGGCATACAACAGGAGGG - Intronic
1151970195 17:77453827-77453849 TGCGAGGCACTTCCACAGGAGGG + Intronic
1152449153 17:80365471-80365493 TGTGACGCCAGGCCACGGGGTGG - Intronic
1159242218 18:65756070-65756092 AATGACACCATTCCACAGCAAGG - Intronic
1159870243 18:73753058-73753080 TGTGACTGCATTCCACACAAGGG - Intergenic
1162512558 19:11128298-11128320 GGTGAGGCTATTCCACAGCACGG - Intronic
1165042795 19:33081013-33081035 TGGGACGGCCTACCACAGGATGG + Exonic
1167733055 19:51273082-51273104 TGTGAAGCCAGTTCAAAGGAAGG - Intergenic
925964348 2:9049945-9049967 TGTGTCCCCATCCCACAGGTTGG - Intergenic
926120031 2:10236763-10236785 TGGGAAGCCATTCCAGAGCAGGG - Intergenic
926370218 2:12171662-12171684 TGCACCCCCATTCCACAGGAGGG - Intergenic
928243079 2:29603516-29603538 TGTGCCTGCATTCCAAAGGAAGG + Intronic
937256153 2:120557342-120557364 GGTGACTCCGTGCCACAGGATGG - Intergenic
938578175 2:132622764-132622786 TGTGATGCCATACCAGAAGAAGG + Intronic
939071067 2:137543668-137543690 TGTGAAGGCAATCCACAGAATGG + Intronic
939341728 2:140904926-140904948 TGTGACTTCATTCCACAGATAGG - Intronic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
1169140426 20:3224495-3224517 TGTGACTCCATCCAGCAGGACGG + Intergenic
1170810839 20:19673065-19673087 TGGGAAAACATTCCACAGGAAGG - Intronic
1172446460 20:34995973-34995995 AGGGACTCCATTACACAGGAGGG + Intronic
1175263016 20:57686540-57686562 TGAGACCCCATTTCACAGCAGGG - Intronic
1184116905 22:42427402-42427424 GGAGACGCGATGCCACAGGAGGG - Intronic
952732782 3:36656776-36656798 ATTGACACCATTCCACAGGATGG + Intergenic
954603526 3:51891346-51891368 TGTGACACCCTTGCACAGCAGGG - Intergenic
955175346 3:56608178-56608200 TTTGACGCTATTCCACAAGATGG - Intronic
956352824 3:68356610-68356632 TGAGAAGCCATCTCACAGGATGG - Intronic
956836485 3:73100330-73100352 GGTGACGGCATTCCACACCACGG - Intergenic
968575900 4:1366008-1366030 TGTGACGCCATTCCACAGGAGGG + Intronic
969532019 4:7735407-7735429 TGTGCCCCCGTTCCACAGGCTGG + Intronic
974553919 4:63418616-63418638 TGTGAGTTCATTCCTCAGGAAGG + Intergenic
987698550 5:21364621-21364643 TGTGCCGCCATTTCAGAAGAAGG + Intergenic
990469800 5:56104854-56104876 TGTGAGGGCATTGCAGAGGAAGG + Intronic
997107931 5:131042765-131042787 TGGGAAGTCAATCCACAGGATGG + Intergenic
997627070 5:135338326-135338348 TCTGATTCCATTTCACAGGATGG - Intronic
1003714715 6:8633516-8633538 TGTGACTCCAGTCCTTAGGAGGG + Intergenic
1005485378 6:26294424-26294446 TGGGACACCATTCCAGAGCAAGG - Intergenic
1005536345 6:26759826-26759848 AATGATGCCCTTCCACAGGAGGG + Intergenic
1005552279 6:26933757-26933779 TGTGCCGCCATTTCAGAAGAAGG - Intergenic
1013900712 6:115153056-115153078 TTTGACACTATTCCACAAGATGG - Intergenic
1015475889 6:133658448-133658470 TATGGCACCATTCCACAGGGTGG + Intergenic
1016814285 6:148289349-148289371 GCTCACGCCTTTCCACAGGAAGG - Intronic
1019060299 6:169252629-169252651 TGAGGCTCCATCCCACAGGAAGG + Intronic
1020116692 7:5480168-5480190 TGAGACACCACCCCACAGGACGG + Intronic
1022423754 7:30248015-30248037 TGTGACACCATTTCAGAGAAAGG + Intergenic
1024600093 7:50972847-50972869 TCTGATTCCATTCCACAGGCTGG + Intergenic
1026889312 7:73972959-73972981 GGTGACGCCATTCCCCACCAGGG + Intergenic
1028958503 7:96721717-96721739 TCTGACTTCATTCCACTGGAGGG - Intergenic
1032366542 7:131305423-131305445 TGTGATGCAATCCAACAGGATGG + Intronic
1034918234 7:155058438-155058460 TGATAAGCCATTCCAAAGGAGGG + Intergenic
1035684684 8:1514667-1514689 TGTCACCCCATTCTAAAGGAGGG + Intronic
1035955697 8:4076740-4076762 TGTGAGGTCATTCCCCAGGGTGG - Intronic
1036592185 8:10179119-10179141 TGGGATGCCATGACACAGGATGG - Intronic
1036748281 8:11425774-11425796 TGTGACGCTATACCAGAGGCAGG - Intronic
1039808355 8:41023018-41023040 TGTCACGCCCTCCCTCAGGAGGG - Intergenic
1040516257 8:48137488-48137510 TGCCACGCCATGCCACAGCATGG + Intergenic
1045799569 8:106086943-106086965 CATGAGGCCATGCCACAGGAAGG + Intergenic
1049187537 8:141265607-141265629 TGTGACGTCATGCCTCAGTAGGG - Intronic
1051133941 9:13896271-13896293 AGTGACTCCATTTTACAGGAAGG + Intergenic
1058913915 9:109546995-109547017 TGGGGTGCCATTCCACTGGAGGG + Intergenic
1059310771 9:113387812-113387834 TTTGCCGCAATTCCACTGGAAGG - Exonic
1061087967 9:128410240-128410262 AGTGTCCCCATTCCACAGGTGGG + Intergenic
1062439308 9:136562604-136562626 AGTGAGTCCATTCCACAGAAGGG - Intergenic
1188919836 X:35959315-35959337 TGGGAAGACAATCCACAGGATGG - Intronic
1189932049 X:46022981-46023003 TCTGACACTATTCCACAAGATGG + Intergenic
1195975956 X:110527034-110527056 TTTGACACTATTCCACAAGATGG + Intergenic
1197524328 X:127544114-127544136 TGAGAAGCCTTTCCAAAGGATGG - Intergenic