ID: 968577532

View in Genome Browser
Species Human (GRCh38)
Location 4:1374879-1374901
Sequence GGGTGCTCACATGGTCCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 129}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968577532_968577544 18 Left 968577532 4:1374879-1374901 CCTTGAGGACCATGTGAGCACCC 0: 1
1: 0
2: 1
3: 11
4: 129
Right 968577544 4:1374920-1374942 GCGGCTGCCACCTCAGGCTTGGG 0: 1
1: 0
2: 2
3: 13
4: 143
968577532_968577550 29 Left 968577532 4:1374879-1374901 CCTTGAGGACCATGTGAGCACCC 0: 1
1: 0
2: 1
3: 11
4: 129
Right 968577550 4:1374931-1374953 CTCAGGCTTGGGTGCTGGGGAGG 0: 1
1: 0
2: 1
3: 63
4: 733
968577532_968577541 12 Left 968577532 4:1374879-1374901 CCTTGAGGACCATGTGAGCACCC 0: 1
1: 0
2: 1
3: 11
4: 129
Right 968577541 4:1374914-1374936 TTCCAAGCGGCTGCCACCTCAGG 0: 1
1: 0
2: 1
3: 11
4: 175
968577532_968577548 26 Left 968577532 4:1374879-1374901 CCTTGAGGACCATGTGAGCACCC 0: 1
1: 0
2: 1
3: 11
4: 129
Right 968577548 4:1374928-1374950 CACCTCAGGCTTGGGTGCTGGGG 0: 1
1: 0
2: 4
3: 38
4: 613
968577532_968577545 24 Left 968577532 4:1374879-1374901 CCTTGAGGACCATGTGAGCACCC 0: 1
1: 0
2: 1
3: 11
4: 129
Right 968577545 4:1374926-1374948 GCCACCTCAGGCTTGGGTGCTGG 0: 1
1: 0
2: 0
3: 17
4: 197
968577532_968577543 17 Left 968577532 4:1374879-1374901 CCTTGAGGACCATGTGAGCACCC 0: 1
1: 0
2: 1
3: 11
4: 129
Right 968577543 4:1374919-1374941 AGCGGCTGCCACCTCAGGCTTGG 0: 1
1: 0
2: 2
3: 19
4: 200
968577532_968577551 30 Left 968577532 4:1374879-1374901 CCTTGAGGACCATGTGAGCACCC 0: 1
1: 0
2: 1
3: 11
4: 129
Right 968577551 4:1374932-1374954 TCAGGCTTGGGTGCTGGGGAGGG 0: 1
1: 0
2: 7
3: 72
4: 591
968577532_968577547 25 Left 968577532 4:1374879-1374901 CCTTGAGGACCATGTGAGCACCC 0: 1
1: 0
2: 1
3: 11
4: 129
Right 968577547 4:1374927-1374949 CCACCTCAGGCTTGGGTGCTGGG 0: 1
1: 0
2: 2
3: 21
4: 234
968577532_968577539 -1 Left 968577532 4:1374879-1374901 CCTTGAGGACCATGTGAGCACCC 0: 1
1: 0
2: 1
3: 11
4: 129
Right 968577539 4:1374901-1374923 CTGTGGGTGGCCTTTCCAAGCGG 0: 1
1: 0
2: 2
3: 20
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968577532 Original CRISPR GGGTGCTCACATGGTCCTCA AGG (reversed) Intronic
900342431 1:2195255-2195277 GGTGGCTCACTTGGGCCTCAGGG + Intronic
901428184 1:9196849-9196871 GGTTCCTCCCATGGTTCTCAGGG + Intergenic
905187659 1:36208162-36208184 GGGTGCTCACATGGGCAGCCTGG - Intergenic
905213215 1:36388732-36388754 GGGTGCTCTGATGCTCCACAAGG - Intergenic
907892540 1:58649605-58649627 GGGTGCTTTCATGTTCCTCATGG - Intergenic
912754633 1:112314026-112314048 GGGTGGGGACATGGGCCTCAGGG - Intergenic
916792378 1:168136247-168136269 GGCTGCTCACCTGGTCCTCACGG + Intronic
917241824 1:172956822-172956844 GGATGCTCACATAGGCCTCGTGG - Intergenic
918140737 1:181717425-181717447 GGGAGGCCACATCGTCCTCAAGG + Intronic
920382915 1:205546102-205546124 GCATGCTCACTAGGTCCTCATGG - Intergenic
921594721 1:217041979-217042001 GAGCCCTCACATGGTACTCATGG - Intronic
924038416 1:239958705-239958727 GGATACTTACATGGTTCTCATGG + Intergenic
1064452687 10:15457572-15457594 GGGTGGTCACATTTTCCACATGG - Intergenic
1068773118 10:60844145-60844167 GGGTGCTTATCTGGGCCTCAGGG + Intergenic
1069802963 10:71093665-71093687 TGGTGCTCAGAAAGTCCTCAGGG - Intergenic
1070169817 10:73924538-73924560 GGGTGCTAACAAGATCCTAAGGG - Intergenic
1072807820 10:98435742-98435764 GGGTGCTGAGCTGGTCCTCCAGG + Exonic
1076028538 10:127138334-127138356 GTCTGTTCACATGGGCCTCATGG + Intronic
1076058010 10:127391317-127391339 GAGTTCTCACATGGCCCTTAAGG + Intronic
1076636621 10:131885365-131885387 GGGTGTCCACATGGTCAGCACGG + Intergenic
1076864581 10:133160557-133160579 GGGGGCTCACCTCGTCCTCGGGG - Exonic
1077152237 11:1077556-1077578 GGATGCACTCATGGTGCTCAGGG + Intergenic
1077316863 11:1923249-1923271 GTGTGGCCACATGGTCCTGAGGG + Intronic
1079359156 11:19756128-19756150 GGGGGCTCAGATGTTCCTCATGG + Intronic
1081616791 11:44596097-44596119 GGGGCCTCACAGGGTCCTCCAGG - Intronic
1084778878 11:71396053-71396075 CAGAGCTCACATGGTCTTCACGG - Intergenic
1085377486 11:76079055-76079077 TGGTGCTGACATGGGGCTCAGGG - Intronic
1089400223 11:118160158-118160180 GGGGGCTCAGAAGGTCCGCACGG - Intergenic
1095049823 12:37545654-37545676 GAATGATCACATGGGCCTCAAGG - Intergenic
1096239609 12:49952726-49952748 GGGTTCTCCCCAGGTCCTCAAGG - Intronic
1097015909 12:55987095-55987117 TGGTGCTCTCCTGGTACTCATGG - Exonic
1097766638 12:63534019-63534041 TGGTGCTCTCATGGTACCCAGGG - Intergenic
1099693875 12:85993944-85993966 GGGTCCTTCCAGGGTCCTCAAGG + Intronic
1103327534 12:120131390-120131412 GGGTGGGCCCATGGGCCTCATGG - Intronic
1104954964 12:132459852-132459874 GGGTGAGCACAGGGTCCACACGG - Intergenic
1107996712 13:45868281-45868303 GGATGCCCTCATGGGCCTCAAGG - Intergenic
1112624822 13:101092276-101092298 GGGTGCCCCCATGTTCCCCAAGG - Intronic
1118767710 14:68921255-68921277 GTGTGCTCACACGCTGCTCAGGG + Intronic
1121728058 14:96167281-96167303 GCCTGCTCACAGGGTGCTCAAGG + Intergenic
1122861599 14:104585034-104585056 AGGGGCCTACATGGTCCTCAAGG - Intronic
1124597277 15:31101766-31101788 AAGTGCTCACATGCTCCTCATGG - Intronic
1125724411 15:41861029-41861051 GGGGACTAACATGGTCCTCCAGG - Intronic
1131107343 15:89744083-89744105 GGTTCCACACAGGGTCCTCACGG - Intergenic
1132733599 16:1375049-1375071 GGTTGCTCCCATGGTCCCCGTGG - Intronic
1133256916 16:4522725-4522747 AGGAGCTCACGTGGGCCTCAGGG + Intronic
1135303021 16:21347080-21347102 GGGTGCACACATGCTGCACAAGG + Intergenic
1136299765 16:29326272-29326294 GGGTGCACACATGCTGCACAAGG + Intergenic
1138166087 16:54802786-54802808 GGGGGGTCACATGGTCCCCCAGG + Intergenic
1140041595 16:71412013-71412035 GGGGGCTCACATTGCCCTTAGGG - Intergenic
1144026371 17:11279519-11279541 GAGGGCTCACATGGACCACAGGG - Intronic
1147399454 17:40171305-40171327 GTGTATTCACATAGTCCTCAGGG + Exonic
1149530764 17:57393201-57393223 GAGTGCTGTCATGGTGCTCAAGG + Intronic
1151570382 17:74922865-74922887 GGGTGGTCTCAGGGGCCTCAAGG + Intronic
1152192616 17:78897679-78897701 GGGTCCTGCCATTGTCCTCAGGG - Intronic
1152878955 17:82804547-82804569 GTGTGCTTCCATGCTCCTCATGG + Intronic
1156594557 18:38533055-38533077 TGGTGCCCACATGGCCCTTATGG + Intergenic
1157209447 18:45729074-45729096 CTGTGATCAAATGGTCCTCATGG - Intronic
1161946872 19:7442856-7442878 GTGTCCTCACAAGGTCTTCATGG + Intronic
1162135412 19:8552171-8552193 GGGTGCTGACATGGTTCTCTCGG - Intronic
1162243757 19:9381393-9381415 GGGTTCTCACATGTTTCTGAAGG - Exonic
1162372744 19:10289052-10289074 GGGTGATCAGATGGTCCACAGGG + Intergenic
1162459443 19:10805811-10805833 GGCTGCTCACTTGGTCCCCAGGG + Intronic
1163641895 19:18466779-18466801 GGGCGCTCAAATAGTCCACAAGG + Intronic
1168471816 19:56646242-56646264 GGGTGCTTGCAGGGTTCTCAGGG + Intronic
928202468 2:29257124-29257146 GGATGATCAAATGGTCCCCAGGG + Intronic
930059054 2:47273361-47273383 GGGTGTTCACAAGGTCATCAAGG - Intergenic
934729826 2:96649520-96649542 GGGTTCACACCTGGTCCTCCTGG - Intergenic
935028884 2:99303365-99303387 GGATGCTAACATGGCCCTCTGGG - Intronic
935413318 2:102788404-102788426 GTGTGCTCACCTGGTCCCCTGGG + Intronic
936271418 2:111052294-111052316 GTGTGCTCTCATGGTGCTGAAGG - Intronic
936284892 2:111174120-111174142 GGGTGCTCAGAGGTCCCTCAAGG + Intergenic
936384921 2:112020683-112020705 GGGGGCTTACTTAGTCCTCAGGG + Intronic
937982613 2:127624239-127624261 CGGTGCTGACAGGGTCCTCCCGG - Exonic
938420100 2:131138840-131138862 GGCTCCCCACATGGTCTTCATGG + Intronic
938902899 2:135812935-135812957 GGTGGCTCACTTGGTCCTCAAGG - Exonic
948629807 2:239294805-239294827 TGGTGCTCACATGACCCTGAGGG - Intronic
948900366 2:240953692-240953714 GGGTCATCACAGGTTCCTCAGGG - Intronic
1169332616 20:4728732-4728754 GGATTTTCAAATGGTCCTCATGG - Intergenic
1169707062 20:8517681-8517703 CGGGGCTCAGATGTTCCTCATGG + Intronic
1170710012 20:18781963-18781985 GGGTGCTCACTTGGATCTCTGGG + Intergenic
1170823418 20:19773184-19773206 GTGTCCTCACATCGTCCTCCAGG + Intergenic
1174141286 20:48415728-48415750 GGGGGTTCATATGGGCCTCAAGG - Intergenic
1178974465 21:37209297-37209319 GGGTGCTCCCATGGGCCTGCAGG - Intergenic
1180161326 21:45999839-45999861 GGGTCCTCCCATGGCCGTCACGG - Intronic
1180161396 21:46000079-46000101 GGGTCCCCTCATGGTCCTCATGG - Intronic
1181240386 22:21473969-21473991 GGGTTCCCACATGCCCCTCAGGG + Intergenic
1181458959 22:23075091-23075113 GGCTGGTCACAGGGACCTCAAGG + Intronic
1181626933 22:24128701-24128723 GGGGGCACAGATGGTGCTCACGG - Intronic
1183218457 22:36496467-36496489 AAGTGCTCACATACTCCTCAGGG - Intronic
1184779402 22:46638968-46638990 GTGCGCTCACCTGGTGCTCAAGG + Intronic
950110888 3:10417903-10417925 GAGGGGTCAGATGGTCCTCAAGG + Intronic
953926794 3:46986697-46986719 CGGGGCCCGCATGGTCCTCATGG + Intronic
954176777 3:48851097-48851119 GGGGGCTCAGATATTCCTCATGG + Intergenic
956389991 3:68761586-68761608 GGGTGATTACATGGGCCCCATGG + Intronic
958114663 3:89200744-89200766 GAGTGTTCACATCGTCCCCATGG + Intronic
968577532 4:1374879-1374901 GGGTGCTCACATGGTCCTCAAGG - Intronic
968716990 4:2167520-2167542 GGGTTCTCAGATGCTCCTCGTGG - Intronic
969608645 4:8215035-8215057 GTGTGCGCACCTGGTGCTCAGGG + Intronic
972991761 4:44829414-44829436 GGGGGCTCAGATGTTCCTCATGG - Intergenic
974564221 4:63563425-63563447 GGGGCCTCACATGGTCCTGCAGG + Intergenic
978999757 4:115201303-115201325 GGGAGCTCACAGGGTCCCCTAGG - Intergenic
983035795 4:162864650-162864672 GGAAGCTCTCTTGGTCCTCAGGG + Intergenic
983428112 4:167613224-167613246 GGGTTATAACATGGTACTCAGGG + Intergenic
992503516 5:77364139-77364161 AGGTGCTCTCATGGCCTTCAAGG - Intronic
1000379971 5:160620371-160620393 GGGTGCTGACTCGGTCATCATGG - Exonic
1000729399 5:164813462-164813484 GGGTCCTCACATGATCCTATGGG - Intergenic
1001649383 5:173304552-173304574 AGGTTCTCAGATGGTACTCAGGG + Intergenic
1007080877 6:39103010-39103032 GGATGCTCACATAGGCCTCCAGG + Intergenic
1007295764 6:40819422-40819444 GGGAGCTCACATTGTCCCCTGGG - Intergenic
1015861710 6:137688094-137688116 AGGTGCTCATATGGCTCTCAAGG - Intergenic
1019478400 7:1255071-1255093 GGGTGCTGACACTGGCCTCAGGG + Intergenic
1019891769 7:3952959-3952981 GGCTGCTCTCATAGTCATCACGG - Intronic
1020282194 7:6655301-6655323 GGGTGTTGACAGGGTCCTGAGGG + Exonic
1022214352 7:28243506-28243528 GGCTCCTCACAAGGTCCTGATGG - Intergenic
1024286886 7:47765593-47765615 GGTTGCTCACTTACTCCTCAGGG + Intronic
1025295730 7:57774235-57774257 GAATGATCACATGGGCCTCAAGG - Intergenic
1026294058 7:69035662-69035684 TGGTGTTCTCATGGTTCTCATGG + Intergenic
1026960399 7:74404177-74404199 GGCCGCTAAGATGGTCCTCAGGG - Exonic
1029616913 7:101664941-101664963 GGGTGCTAATATGGCCCCCAGGG - Intergenic
1029647997 7:101870028-101870050 AGGTGCTCAAATGGCCCACAGGG - Intronic
1030741412 7:113114086-113114108 GGCTACCCACATGGTCTTCATGG - Intergenic
1032431123 7:131862552-131862574 TGGTCCTCACGTGGTCCTCACGG - Intergenic
1034922906 7:155098609-155098631 AGCTGCTCAAATGGTGCTCAGGG + Intergenic
1034944308 7:155252008-155252030 GGGTGTTCCCATGGTGCACAGGG + Intergenic
1036488560 8:9202249-9202271 GGTTGCTCATTTGGTTCTCAGGG - Intergenic
1037844158 8:22267922-22267944 GGCTTCTCAAATGGTCCTGACGG + Intergenic
1037859933 8:22397998-22398020 TGGTTCTCACATATTCCTCAGGG - Intronic
1039235888 8:35502412-35502434 GGGAGCTCCCATGGTCATCTGGG - Intronic
1042841154 8:73125199-73125221 GGCTGATCTCAGGGTCCTCATGG - Intergenic
1047093108 8:121595022-121595044 AGGAGCTCAGATGTTCCTCATGG + Intergenic
1047362688 8:124183654-124183676 GGGAGCTCAGAGGGGCCTCAGGG + Intergenic
1049184350 8:141241660-141241682 TGGTGCTGACAGGGTCCTCTGGG + Intronic
1050595611 9:7201568-7201590 GGGTGCTTCCATGTTCCTCCAGG + Intergenic
1057146316 9:92761560-92761582 AGGTGCCCATGTGGTCCTCATGG - Intronic
1059215853 9:112561434-112561456 CTGTGCTCACATGGAACTCATGG - Intronic
1059931597 9:119266150-119266172 GGGAGGTCCCATGTTCCTCAAGG + Intronic
1060733569 9:126052451-126052473 CAGGGCTCACCTGGTCCTCAAGG - Intergenic
1060784464 9:126439250-126439272 GGGAGCTCACAGGGTCCGCTGGG + Intronic
1185762564 X:2700021-2700043 TGGTGATCACATGGTCAGCATGG + Intronic
1190193957 X:48300957-48300979 AGGTGCAGACAAGGTCCTCAAGG + Intergenic
1190660472 X:52649616-52649638 AGGTGCAGACAAGGTCCTCAAGG + Intronic
1195239369 X:102935758-102935780 AGGTGCTCTCAGGGTCCTCTAGG - Intergenic