ID: 968577532

View in Genome Browser
Species Human (GRCh38)
Location 4:1374879-1374901
Sequence GGGTGCTCACATGGTCCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968577532_968577547 25 Left 968577532 4:1374879-1374901 CCTTGAGGACCATGTGAGCACCC No data
Right 968577547 4:1374927-1374949 CCACCTCAGGCTTGGGTGCTGGG 0: 1
1: 0
2: 2
3: 21
4: 234
968577532_968577541 12 Left 968577532 4:1374879-1374901 CCTTGAGGACCATGTGAGCACCC No data
Right 968577541 4:1374914-1374936 TTCCAAGCGGCTGCCACCTCAGG 0: 1
1: 0
2: 1
3: 11
4: 175
968577532_968577544 18 Left 968577532 4:1374879-1374901 CCTTGAGGACCATGTGAGCACCC No data
Right 968577544 4:1374920-1374942 GCGGCTGCCACCTCAGGCTTGGG 0: 1
1: 0
2: 2
3: 13
4: 143
968577532_968577550 29 Left 968577532 4:1374879-1374901 CCTTGAGGACCATGTGAGCACCC No data
Right 968577550 4:1374931-1374953 CTCAGGCTTGGGTGCTGGGGAGG 0: 1
1: 0
2: 1
3: 63
4: 733
968577532_968577548 26 Left 968577532 4:1374879-1374901 CCTTGAGGACCATGTGAGCACCC No data
Right 968577548 4:1374928-1374950 CACCTCAGGCTTGGGTGCTGGGG 0: 1
1: 0
2: 4
3: 38
4: 613
968577532_968577551 30 Left 968577532 4:1374879-1374901 CCTTGAGGACCATGTGAGCACCC No data
Right 968577551 4:1374932-1374954 TCAGGCTTGGGTGCTGGGGAGGG 0: 1
1: 0
2: 7
3: 72
4: 591
968577532_968577543 17 Left 968577532 4:1374879-1374901 CCTTGAGGACCATGTGAGCACCC No data
Right 968577543 4:1374919-1374941 AGCGGCTGCCACCTCAGGCTTGG 0: 1
1: 0
2: 2
3: 19
4: 200
968577532_968577539 -1 Left 968577532 4:1374879-1374901 CCTTGAGGACCATGTGAGCACCC No data
Right 968577539 4:1374901-1374923 CTGTGGGTGGCCTTTCCAAGCGG 0: 1
1: 0
2: 2
3: 20
4: 180
968577532_968577545 24 Left 968577532 4:1374879-1374901 CCTTGAGGACCATGTGAGCACCC No data
Right 968577545 4:1374926-1374948 GCCACCTCAGGCTTGGGTGCTGG 0: 1
1: 0
2: 0
3: 17
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968577532 Original CRISPR GGGTGCTCACATGGTCCTCA AGG (reversed) Intronic