ID: 968580057

View in Genome Browser
Species Human (GRCh38)
Location 4:1385589-1385611
Sequence AGGTGGCCCCAGCCCCACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 408}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968580057_968580069 25 Left 968580057 4:1385589-1385611 CCAAGGTGGGGCTGGGGCCACCT 0: 1
1: 0
2: 4
3: 49
4: 408
Right 968580069 4:1385637-1385659 GACTCCGCTTCTGGGACCTGGGG 0: 1
1: 0
2: 0
3: 13
4: 145
968580057_968580067 23 Left 968580057 4:1385589-1385611 CCAAGGTGGGGCTGGGGCCACCT 0: 1
1: 0
2: 4
3: 49
4: 408
Right 968580067 4:1385635-1385657 CAGACTCCGCTTCTGGGACCTGG 0: 1
1: 0
2: 1
3: 10
4: 266
968580057_968580068 24 Left 968580057 4:1385589-1385611 CCAAGGTGGGGCTGGGGCCACCT 0: 1
1: 0
2: 4
3: 49
4: 408
Right 968580068 4:1385636-1385658 AGACTCCGCTTCTGGGACCTGGG 0: 1
1: 0
2: 0
3: 12
4: 232
968580057_968580065 17 Left 968580057 4:1385589-1385611 CCAAGGTGGGGCTGGGGCCACCT 0: 1
1: 0
2: 4
3: 49
4: 408
Right 968580065 4:1385629-1385651 CCGCCGCAGACTCCGCTTCTGGG 0: 1
1: 0
2: 1
3: 20
4: 274
968580057_968580070 28 Left 968580057 4:1385589-1385611 CCAAGGTGGGGCTGGGGCCACCT 0: 1
1: 0
2: 4
3: 49
4: 408
Right 968580070 4:1385640-1385662 TCCGCTTCTGGGACCTGGGGCGG 0: 1
1: 0
2: 0
3: 18
4: 187
968580057_968580063 16 Left 968580057 4:1385589-1385611 CCAAGGTGGGGCTGGGGCCACCT 0: 1
1: 0
2: 4
3: 49
4: 408
Right 968580063 4:1385628-1385650 CCCGCCGCAGACTCCGCTTCTGG 0: 1
1: 0
2: 3
3: 9
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968580057 Original CRISPR AGGTGGCCCCAGCCCCACCT TGG (reversed) Intronic
900114810 1:1023966-1023988 CGGTGGCCACAGCCCCTCCCGGG - Intronic
900157192 1:1207872-1207894 AGGTGATCCGAGGCCCACCTCGG - Intergenic
900298050 1:1962237-1962259 AGGTGATCCGAGGCCCACCTCGG - Intronic
900748317 1:4376743-4376765 AGGAGACCCCAGGCCCATCTTGG + Intergenic
901037860 1:6347118-6347140 GGGGGTCCCCTGCCCCACCTAGG + Intronic
901306389 1:8236073-8236095 AGGAGTCGCCAGCCCTACCTGGG + Intergenic
901857799 1:12055414-12055436 GGGTGGCCGGTGCCCCACCTGGG + Intergenic
902243532 1:15103946-15103968 AGGGGGCCCCAGTTCCACGTGGG - Intronic
902387365 1:16083495-16083517 AGCCAGCCCCAGCCCCTCCTGGG - Intergenic
902573381 1:17361140-17361162 AGGCAGTGCCAGCCCCACCTGGG + Intronic
903130589 1:21277121-21277143 AGGTGACCCCTGAGCCACCTGGG - Intronic
903187080 1:21634795-21634817 AGGTGGCCTGAGCCCCACTGTGG + Intronic
903318256 1:22525770-22525792 AGGCTGCCCCGGGCCCACCTGGG + Intronic
903474968 1:23613352-23613374 CGTTAGCCCCCGCCCCACCTGGG + Intronic
903831578 1:26178391-26178413 AGGTTGACACAGCCCCACCCTGG + Intronic
903857136 1:26344083-26344105 AGCTGGGCCCAGCCCCTCCAGGG - Exonic
903943467 1:26947322-26947344 AGCTGACCCCTGCCCCACTTTGG + Intergenic
904000380 1:27335475-27335497 CGGTGGCCCCACACCCACCAGGG + Exonic
904029101 1:27522980-27523002 AGGGGGGGCCAGCCCCAGCTCGG + Intergenic
904293093 1:29500154-29500176 GGGAGTCCACAGCCCCACCTAGG - Intergenic
904296747 1:29524351-29524373 AGGGGCCCCTAGCCCAACCTGGG - Intergenic
904379871 1:30103414-30103436 AGGCTGACCCAGCCCCTCCTGGG + Intergenic
904676225 1:32200845-32200867 CGGTCGCCCCAGCCGCTCCTGGG + Intronic
904851436 1:33462683-33462705 AGTGCTCCCCAGCCCCACCTAGG - Intergenic
904956123 1:34285282-34285304 AGGTGTCCCCTGCCACACTTGGG - Intergenic
905001166 1:34671245-34671267 GGGTGGCCACAGCTGCACCTAGG - Intergenic
905626848 1:39495085-39495107 TGGTGGCCCCAGAGCCACCATGG + Intronic
907305358 1:53509970-53509992 CGGTGGCCCCAGCCCCTTCAGGG + Exonic
907585636 1:55615468-55615490 TGATGGCCCCAGGCGCACCTTGG - Intergenic
907605744 1:55815767-55815789 AGCTGGCCCAAGCCCCAAGTTGG - Intergenic
910625524 1:89302881-89302903 AGGAGGCCCAAGCCTCCCCTAGG - Intergenic
910993513 1:93079630-93079652 AGGAGCCCCCACCCCCACCTTGG - Intronic
912505089 1:110150755-110150777 GGGTCGCCCCAGCCCCAGCCGGG + Exonic
912655355 1:111481782-111481804 AGGTGGCCACAGCACCACCAGGG + Intergenic
915712162 1:157910566-157910588 TGGTGGCCCAAGCCATACCTGGG - Intergenic
919083361 1:192891940-192891962 GGGTGGCCACAGCCCCACCCAGG + Intergenic
921097763 1:211901738-211901760 AGCTGCCCTCAGCCCCACCTAGG - Intergenic
921706019 1:218323697-218323719 AGCTGCCCTTAGCCCCACCTCGG + Intronic
923005359 1:230045216-230045238 AGGTGGTCTCAGTCCCACCCAGG + Intergenic
1062800538 10:376271-376293 AGAAGGACCCAGGCCCACCTCGG + Intronic
1062800555 10:376315-376337 AGAAGGACCCAGGCCCACCTCGG + Intronic
1062908720 10:1198615-1198637 AGGTGGCACCTGCCACACCACGG - Intronic
1062923790 10:1299336-1299358 ACGTGGCCACAGCCCCAGCCTGG + Intronic
1063133034 10:3194921-3194943 AGGGGGCCCCAGCCCAGCCCAGG - Intergenic
1063504402 10:6582810-6582832 TGGTGGCTCCAGCCTGACCTGGG - Intergenic
1064199100 10:13269801-13269823 AGGTGGCTCCCGCCTCACTTTGG + Intergenic
1064428230 10:15248857-15248879 AGGTTTCCACAGCCCCACATGGG - Intronic
1064981575 10:21172265-21172287 AACTGGCCCCTGCCACACCTGGG + Intronic
1066239691 10:33521575-33521597 AGGAGTCTCCAGCCCCTCCTTGG + Intergenic
1067279657 10:44861570-44861592 AGCTGGACCCAGCCCCACCCTGG + Intergenic
1069198345 10:65581949-65581971 AGCTGGCAACACCCCCACCTGGG - Intergenic
1070201224 10:74207938-74207960 AGCTGCCCTCAGTCCCACCTTGG + Intronic
1070550614 10:77488221-77488243 AGCTGGCCACAGCCACAACTTGG - Intronic
1070935748 10:80293657-80293679 ACATTGCCCCAACCCCACCTGGG + Intergenic
1071052906 10:81473269-81473291 AGCTGCCCTCAGCCCCTCCTTGG - Intergenic
1071563546 10:86660219-86660241 AGGTGGCCCCCCACCCACCCCGG - Intronic
1072572718 10:96672749-96672771 AGAGGGCCCCAGCCCCAGCTGGG - Intronic
1073083364 10:100873596-100873618 GGGTGGCCCAAGACCCATCTGGG - Intergenic
1074028739 10:109663673-109663695 AGCTGCCCTCAGCCCCTCCTTGG - Intergenic
1074389565 10:113045499-113045521 AGGGAACCCCAGCCCCACCTGGG + Intronic
1074533136 10:114310609-114310631 ATGTGGCCTCAGACCCAGCTGGG + Intronic
1074775299 10:116763635-116763657 AGCTGGCTCCAGTCCCAACTTGG + Intergenic
1075067047 10:119296072-119296094 AGGTGGCCCCAGGACGAGCTTGG + Intronic
1076080857 10:127579127-127579149 AGGTGACCCCAGCACCACTGTGG + Intergenic
1076495964 10:130898106-130898128 AGGTGGCCCCTGCCTGCCCTGGG + Intergenic
1076631889 10:131856554-131856576 AGGAGGCACCACCCCGACCTGGG - Intergenic
1076796642 10:132801570-132801592 AGATGTCCCCGCCCCCACCTCGG - Intergenic
1076808008 10:132869024-132869046 GGGTGGCCCGAGCCCCTCCCCGG - Intronic
1076835580 10:133019485-133019507 GAGAGGCCCCAGCTCCACCTAGG - Intergenic
1076872284 10:133199967-133199989 AGGTGGCCCCAGACCCCACAGGG + Intronic
1076904578 10:133355666-133355688 AGCTGCCCCCATCCCCACCGGGG - Intronic
1077012751 11:386103-386125 AGCTGCCCCCAGCTCCATCTTGG - Intergenic
1077100834 11:821623-821645 ACTTGGCACCAGCCTCACCTGGG - Exonic
1077160330 11:1109737-1109759 TGGTGCCCTCAGCCCCGCCTGGG + Intergenic
1077176833 11:1194946-1194968 GGCTGGCCCCACCCCCAGCTGGG - Intronic
1077184153 11:1228919-1228941 CGGAGGCCCCACCCCCTCCTGGG - Intronic
1077473395 11:2775344-2775366 ACATGGCCCCAGCCCCACTGTGG + Intronic
1077549963 11:3195818-3195840 GGTTGGCCCCAGGGCCACCTAGG - Intergenic
1077555916 11:3225972-3225994 AGGTGTCCTCAGCCCCACACTGG - Intergenic
1078427221 11:11261715-11261737 AGGGGGCCCCAGTCTCACCCTGG + Intergenic
1078533679 11:12156514-12156536 AGGTGTCCCCAGCCTGGCCTCGG - Intronic
1079183510 11:18215158-18215180 AGGTGCCACCAGCGCCACATGGG + Intronic
1080503505 11:32892154-32892176 AACTGTCCCCACCCCCACCTTGG - Intergenic
1081429621 11:42962167-42962189 TGGTGGCCCAAGCCACACCTTGG + Intergenic
1081656907 11:44863358-44863380 AGATGGCCCCAGGCCCAGCACGG - Intronic
1083163098 11:60867637-60867659 AGGTGGCTCCAGCCCGACCCTGG + Exonic
1083306550 11:61764793-61764815 CGCTGGCCCCGGCCCCACCAAGG - Intronic
1083331926 11:61902705-61902727 AGCTGGCCCCAGCCATCCCTGGG + Intronic
1083762311 11:64825403-64825425 AGGTGGCACCAGCCCCAGGGAGG + Intronic
1083955086 11:65978543-65978565 AGGTGGCTCCGGCCCCACCCAGG + Intronic
1084004302 11:66315062-66315084 AGATGGCCCCAGTCCCAAGTTGG - Exonic
1084365613 11:68695876-68695898 AGGTGGCCCAAACCCCAACCAGG + Intergenic
1084705004 11:70810996-70811018 AGGTGGCCCCAGTGTCCCCTGGG + Intronic
1084706730 11:70820170-70820192 AGGTGACCCCAGCCCCCCAAGGG + Intronic
1084942386 11:72619949-72619971 AGGTGGCCCCAGCCCCCTGCTGG - Intronic
1085640838 11:78191668-78191690 CGGTGTTCCCAGCCCCACCCAGG - Intronic
1085792264 11:79506413-79506435 AGGTGGCTCCACCCTGACCTGGG - Intergenic
1086249276 11:84794851-84794873 AGCTGCCCTCAGCCCCACCTCGG - Intronic
1088728504 11:112660058-112660080 AGGTGGACTCAGCCTCACTTTGG + Intergenic
1089278588 11:117356472-117356494 AGGTGGCCCTCGCCCCTGCTTGG + Intronic
1089315332 11:117587436-117587458 TGGTGTCCCCAGACCCACCATGG - Intronic
1089683690 11:120133605-120133627 AAGTGGGCCCAGCCCCTCCAGGG + Intronic
1090405747 11:126475000-126475022 TGGTGGGCCCAGCTCCTCCTGGG - Intronic
1091125392 11:133091132-133091154 TGGTGGCCCAAGCTGCACCTGGG - Intronic
1091192865 11:133708796-133708818 CCTTGGCCCCAGGCCCACCTGGG + Intergenic
1091384753 12:86190-86212 TGCTGGCCTCTGCCCCACCTAGG - Intronic
1091550473 12:1531611-1531633 AGGTGGCCCCGGCCCTGCGTTGG + Intronic
1091992106 12:4963869-4963891 AGGTGTGTCCACCCCCACCTCGG - Intergenic
1092943061 12:13428294-13428316 TGGTGGCCCCAGACACCCCTTGG - Intergenic
1093961314 12:25275940-25275962 AGGTGACCTCAGGCCCGCCTTGG - Intergenic
1095977022 12:47946826-47946848 AGGTCTCCCCACCCCCACCGAGG + Intergenic
1097063021 12:56300107-56300129 CGGTCGCCTCAGCCCCACCCTGG + Intronic
1097896019 12:64825220-64825242 GGGTGGCCGCTGCCCCACCCAGG - Intronic
1098392636 12:69985779-69985801 TGGTGGCCACAGTCCCACCCTGG - Intergenic
1098597879 12:72294794-72294816 AGCTGCCCTCAGCTCCACCTTGG + Intronic
1100836251 12:98569714-98569736 AGCTGGCTCCAGCCCCATTTAGG - Intergenic
1102218294 12:111177347-111177369 AGGAAGCCCCAGCCACCCCTTGG - Intronic
1102284254 12:111642454-111642476 CAGTGGCCCCACCACCACCTGGG - Exonic
1102931795 12:116867958-116867980 CAGTGTCCCCAGCCCCTCCTGGG - Intronic
1103272871 12:119688095-119688117 AGCGGGGCCCAGACCCACCTCGG - Exonic
1103520979 12:121537043-121537065 AGGCGGCCCCAGCCCCCCGAGGG - Intronic
1103936526 12:124480338-124480360 ACCTGGCCACAGCCCCACCCTGG + Intronic
1104751926 12:131245383-131245405 AGGTGCCCTCAGCCACACTTGGG - Intergenic
1104761655 12:131300584-131300606 AGGAGGCCCCAGTGCCAGCTCGG + Intergenic
1104768802 12:131347055-131347077 AGGTGTGCCCAGCCTAACCTGGG + Intergenic
1104818118 12:131660208-131660230 AGGAGGCCCCAGTGCCAGCTCGG - Intergenic
1104944000 12:132407570-132407592 AGATGGCCCCAGCGCCCCCGAGG + Intergenic
1105436222 13:20380600-20380622 TGGTGGCCCCAGCCGTTCCTTGG - Intergenic
1106770569 13:32957503-32957525 TGGTACCCCCAGCCCCAGCTGGG - Intergenic
1107841099 13:44458868-44458890 AGCTGCCCTCAGCCCCACCCTGG - Intronic
1107891737 13:44920386-44920408 AGTTTGCCCCAGCCCAACTTGGG + Intergenic
1108455318 13:50607727-50607749 CAGTGGCCCCAGCACCACCATGG - Intronic
1111512787 13:89287797-89287819 GGGTGGCTGCAGCCCCACCTGGG + Intergenic
1111546272 13:89741193-89741215 GGGTGGCTGCAGCCACACCTGGG - Intergenic
1111698379 13:91654805-91654827 AAATGGGCCAAGCCCCACCTGGG - Intronic
1112051758 13:95649811-95649833 TGGTGGCCTGAGCCACACCTGGG + Intergenic
1113711411 13:112467542-112467564 AGCAGGTCGCAGCCCCACCTGGG + Intergenic
1116257142 14:42571041-42571063 TGGTGGCCGCAGCCCCACCTGGG - Intergenic
1119706354 14:76784981-76785003 AGGTGGCCCCTCCCACTCCTGGG + Intergenic
1119764705 14:77181254-77181276 AATTGGCCACAGCCCCACCAGGG - Intronic
1121153034 14:91654655-91654677 AGTTGCCCCCAGCCCCAGCTAGG - Intronic
1121411986 14:93754568-93754590 AGCTGGCCACACCCACACCTTGG + Intronic
1121553465 14:94819502-94819524 AGGTGGCCCCAGCGGCACCTGGG + Intergenic
1121688147 14:95855091-95855113 AGGTGCCCAGAACCCCACCTGGG - Intergenic
1122359342 14:101150320-101150342 AGCTGGCCCCCGCCCCTCCCAGG - Intergenic
1122536977 14:102472181-102472203 GGGTGGCTCCAGCCCCACTGAGG - Intronic
1122855460 14:104557881-104557903 AAGTGGCCCCAGGCTCAGCTGGG + Intronic
1202868143 14_GL000225v1_random:136131-136153 CCCTGGCCCCAGCCCCACCACGG + Intergenic
1123970574 15:25504403-25504425 AGTGTGCCCCAGGCCCACCTAGG + Intergenic
1124202848 15:27693200-27693222 AGGCGGCCCTAGCCCCTCATGGG - Intergenic
1124436234 15:29651800-29651822 AGCTGCCCTCAGCCCCTCCTTGG - Intergenic
1125575425 15:40752137-40752159 AGGCATCTCCAGCCCCACCTGGG + Exonic
1125590553 15:40852158-40852180 TGGTGGCCCCAGGCGTACCTTGG + Intronic
1125766930 15:42142347-42142369 AGATGGGGCCAGCCCCTCCTGGG - Intronic
1125833477 15:42731792-42731814 CGGTGCCCCCAGCACCACCAGGG + Exonic
1127409447 15:58691265-58691287 AGGTAGCTCCAGACCCTCCTTGG + Intronic
1127453879 15:59140784-59140806 AGGGGCGCCCAGCCCCTCCTGGG - Intronic
1127905371 15:63372363-63372385 AGGTGGCGCTGGCCCCATCTTGG + Intronic
1128326392 15:66726639-66726661 AGGTAGCACCACCCCTACCTGGG + Intronic
1128330299 15:66751264-66751286 AGGTGGGGCCAGTCCCAGCTCGG + Intronic
1128513550 15:68327969-68327991 AGGTCGCCCAAGAGCCACCTTGG - Intronic
1128734537 15:70045601-70045623 AGGTGGCCCCAACCCCAGCATGG - Intergenic
1128965141 15:72051378-72051400 AGGTGGCCGCAGCTGCACCTAGG - Intronic
1129882821 15:79018294-79018316 ATTTGGCCCCAGAACCACCTTGG - Intronic
1129928302 15:79385494-79385516 AGGTGGCTGCAGCTGCACCTGGG + Intronic
1130227868 15:82073418-82073440 AGGGAGCTCCAGCCCCAACTCGG + Intergenic
1130916364 15:88308118-88308140 ATGTGGCCCCAGCTTCACCAGGG - Intergenic
1131214914 15:90529236-90529258 AGCAGGTGCCAGCCCCACCTTGG - Intergenic
1131254202 15:90851155-90851177 AGGTGGACCTGGCCCCACCCTGG - Intergenic
1131259696 15:90882038-90882060 AGGTGGGCCCAGGACCAGCTGGG + Exonic
1132854783 16:2039884-2039906 CGGTGGCCACAGCGGCACCTCGG + Exonic
1132992827 16:2805899-2805921 GGGTGCCCACAGCCTCACCTAGG - Intergenic
1133305168 16:4803966-4803988 AGGATGTCCCAGACCCACCTCGG + Exonic
1133989409 16:10692888-10692910 AGGCGGCTCCAGCCTCAACTTGG - Intronic
1135738433 16:24953012-24953034 TGGAGGCCCCAGCCCCAATTCGG + Exonic
1137717655 16:50608560-50608582 AGGTGACCGGACCCCCACCTGGG - Intronic
1138376861 16:56570139-56570161 AGCTGAGCCCAGCCCAACCTGGG - Intergenic
1138394702 16:56695252-56695274 GGGTGGCTGCAGCCCCATCTAGG - Intronic
1139440926 16:66966433-66966455 TGCTGTCCCCAGCCCCACCTGGG - Intronic
1141685719 16:85568759-85568781 AGCTGGCCCCAGCCCAGCCCTGG - Intergenic
1141950565 16:87336533-87336555 CTGTGGCCCCCGCCTCACCTGGG - Intronic
1142471365 17:164999-165021 AGGGAGCCCCAGCCTCCCCTTGG - Intronic
1142995029 17:3755099-3755121 AGGTGGCCCCGCCCTCACCCAGG + Exonic
1143114884 17:4576767-4576789 CGGAGGCACCAGCCCCTCCTCGG - Intergenic
1143585439 17:7848201-7848223 GGGTGGCCCCGGCCCCACCTCGG - Exonic
1143621944 17:8085899-8085921 AGGGGGGCCCAGCCCCACCAGGG - Intronic
1143978124 17:10845206-10845228 TGCTGGCCCCTGCCCCTCCTGGG + Intergenic
1144913278 17:18700862-18700884 AGGTGGCCACAGACTCACCGTGG + Intronic
1145902738 17:28498810-28498832 GGGTGGCTCCAGCCCCACCCTGG + Intronic
1147557306 17:41487558-41487580 AGGGCACCCCAGCCCCACCTGGG + Exonic
1147715766 17:42507241-42507263 AAGAGGCACCAGCCTCACCTGGG - Intronic
1147967076 17:44199408-44199430 AGGGGGCCCAAGCCCCGCCTTGG + Intronic
1148048561 17:44758597-44758619 AGGCTGCCCCAGCCCCAGCTTGG - Intergenic
1148757411 17:49980830-49980852 ACGTGGCCCCATCCCCTCTTAGG - Intergenic
1148777642 17:50104710-50104732 CATGGGCCCCAGCCCCACCTGGG + Intronic
1149524204 17:57341213-57341235 GTGTGGCCCCAGCATCACCTAGG + Intronic
1150521004 17:65866359-65866381 AGCTGCCCTCAGCCCCGCCTTGG - Intronic
1150791634 17:68204762-68204784 AGGTGGTCAAAGTCCCACCTGGG + Intergenic
1151474122 17:74335852-74335874 AGCTGGCTGAAGCCCCACCTGGG + Intronic
1152139794 17:78529717-78529739 GTGTGGCCCCAGCCCCCCTTAGG + Intronic
1152247120 17:79190782-79190804 CAGTGGCCCCAGTCCCTCCTGGG - Intronic
1152549592 17:81022755-81022777 TGGTGGCCCCTCCCCCACCCTGG - Intergenic
1152549656 17:81022875-81022897 TGGTGGCCCCTCCCCCACCCTGG - Intergenic
1152549688 17:81022935-81022957 TGGTGGCCCCTCCCCCACCCTGG - Intergenic
1152758515 17:82097102-82097124 AGGTGGCCCCTGCCCCACTGTGG + Intronic
1152854751 17:82658423-82658445 AGGGGGCCGCTGACCCACCTCGG + Intronic
1156154720 18:34287946-34287968 TGGTGGCCCCAGCTGTACCTGGG + Intergenic
1156481039 18:37436583-37436605 AGGTGGCCCCAGCACTTCCCTGG + Intronic
1157443208 18:47725755-47725777 AGGGGACCCTAGCCCCACCCAGG + Intergenic
1157443481 18:47727774-47727796 ACGTGGCCCCATCAACACCTTGG + Intergenic
1158936437 18:62369222-62369244 AGCCAGCCCCAGCCCCAACTGGG + Exonic
1160147581 18:76377535-76377557 AGGTGACCCCAGCACCCACTGGG + Intronic
1160157241 18:76442997-76443019 GCGAGGCCCCAGCCCCACCAGGG - Exonic
1160678369 19:402192-402214 AGGCGGCCTCAGACCCACCCAGG - Intergenic
1160750313 19:731034-731056 AGGTGCCCAGAGCCCCACCGGGG + Intronic
1160910499 19:1471729-1471751 AGGAAACCCCAGCCCCACCACGG + Exonic
1160967519 19:1753240-1753262 CGAGGCCCCCAGCCCCACCTGGG + Exonic
1161767674 19:6216245-6216267 AGGTGGCCCCAGTCCAGCCTGGG - Intronic
1162066635 19:8129682-8129704 ATTTGGCCCCTGCCCCACCGAGG - Intronic
1163358364 19:16829617-16829639 GCCCGGCCCCAGCCCCACCTCGG + Intronic
1163540912 19:17909642-17909664 AGCTGGCTCCAGGCCCACCTGGG + Intergenic
1163576768 19:18115482-18115504 CTGTGGCCCCATCCCCACTTGGG + Intronic
1163587160 19:18170236-18170258 AGCTGGCCCCAACCCCTCCTAGG + Exonic
1164746882 19:30622901-30622923 AGGAAGCCCCTGCCCCATCTTGG + Intronic
1165060022 19:33200633-33200655 AAGTGGCCCCGGCCCCAGCCTGG - Intronic
1165230019 19:34381064-34381086 AGGTGGCCCCTGCCCACACTTGG + Intronic
1165330824 19:35140413-35140435 AGGTGCCACCTGCCCCATCTGGG + Intronic
1165783410 19:38446794-38446816 AGGTGACCCCAGCCTCTCCCTGG - Intronic
1165823853 19:38694243-38694265 AGAAGGCCCCAGCCCACCCTTGG - Intronic
1166094126 19:40529197-40529219 GGGCGTCCCCACCCCCACCTCGG - Intronic
1166283485 19:41810034-41810056 AGGGGTTCCCAGCCACACCTGGG - Intronic
1166702724 19:44891477-44891499 AGGTGGCGGCAGCCCCACGAGGG - Exonic
1166841332 19:45698917-45698939 AGGTGGGCCCCAGCCCACCTGGG + Intronic
1167271284 19:48507991-48508013 AAGGGGCCCCATCCACACCTGGG + Intronic
1167503433 19:49859713-49859735 AGGTGGCCCCAGACACAGCCTGG + Intronic
1167665319 19:50820107-50820129 AGGAGTCCCCATCCCCGCCTTGG + Intronic
1168293530 19:55368591-55368613 AGGTGGCCCCTGCCCAGCCTCGG + Intronic
1168296410 19:55379146-55379168 AGGTGTGGCCAGGCCCACCTGGG + Intergenic
925046530 2:777145-777167 TGGTGGCCCGAGGCCCAGCTGGG - Intergenic
926599360 2:14825222-14825244 AGGTGGCCAGAGCCCCATCGTGG - Intergenic
926864041 2:17339638-17339660 AAGTGGCCCCACCACCATCTTGG + Intergenic
927654498 2:24933898-24933920 AAGTGGCCTCAGCATCACCTGGG - Intergenic
927849502 2:26489941-26489963 AGCCAGCACCAGCCCCACCTAGG - Intronic
927850363 2:26494874-26494896 GGGTGGCCCCAGCCCTCCCCAGG - Intronic
928440449 2:31287775-31287797 AGATGGCGCCAGCCCTTCCTTGG - Intergenic
929014527 2:37481489-37481511 AGCTGCCCTCAGCCCCACCTTGG - Intergenic
930702505 2:54472699-54472721 AGGCAGCCCCAGCCCCACCCAGG - Intronic
934653009 2:96103186-96103208 AGGTGGCCCCAGCCCAGGCCTGG + Intergenic
934903725 2:98181229-98181251 GGGAGGCCCCAGCCCCTCCCAGG - Intronic
934985383 2:98881277-98881299 CAGCGGCCTCAGCCCCACCTGGG + Intronic
935062689 2:99622131-99622153 AGGGGTCTCCAGCCCCACTTTGG + Intronic
935170670 2:100609184-100609206 AGCTGGGGCCAGCACCACCTGGG - Intergenic
936292570 2:111237889-111237911 AGATGGACCCAGCCCACCCTTGG + Intergenic
940174556 2:150864023-150864045 TGGTGGCCCAAGCCACACCTGGG + Intergenic
942956782 2:181782785-181782807 AGGTGGCCCCAGGCCTTCCTAGG - Intergenic
944563326 2:200963398-200963420 AGGTGCACCCAGCCCCGCGTCGG - Intronic
945471697 2:210234453-210234475 TGGTGGCCCCAGGCACTCCTTGG - Intergenic
946326154 2:218985570-218985592 TGGTGTACCCGGCCCCACCTCGG + Exonic
947348678 2:229220431-229220453 AGTTGGCCCCAAGCCCACATGGG + Intronic
947461313 2:230306757-230306779 AGCTGGCCCCAGCCCATTCTTGG - Intronic
947622702 2:231601020-231601042 AGGTGGCCCAATCCCCACAATGG + Intergenic
948293634 2:236845465-236845487 GGGTGGCCACAGCTGCACCTGGG + Intergenic
948366169 2:237456247-237456269 GGGTGGCACCGGGCCCACCTGGG + Intergenic
948457838 2:238115194-238115216 AGGAGGCCACAGCGCCACCAGGG - Intronic
1168748371 20:264087-264109 AGCTGCCCTCAGCCCCACCTCGG - Intergenic
1168828934 20:833829-833851 AGGAGGCCCCAGCCCCGCGTGGG - Exonic
1169022602 20:2340747-2340769 GGGTGGACCCAGCCCCAACCTGG - Exonic
1170032308 20:11956266-11956288 ACGTGGCCCCAGCCTCAGCCTGG + Intergenic
1170414300 20:16123733-16123755 AGGACTCCCCAGCCCCACCCTGG - Intergenic
1170500969 20:16974941-16974963 AGCTGCCCTCAGTCCCACCTTGG - Intergenic
1170791054 20:19509864-19509886 AGGTGGCCAAAGCCACACTTTGG + Intronic
1171386390 20:24771997-24772019 AGGCGGCAGCAGCCCTACCTGGG + Intergenic
1171413731 20:24963633-24963655 AGGATGCCCGGGCCCCACCTGGG - Exonic
1171902740 20:30872311-30872333 AGATAGCCCTAGCCCCACCCCGG - Intergenic
1172529223 20:35618719-35618741 AGGTGAGCCCCGGCCCACCTTGG + Exonic
1172636873 20:36415923-36415945 AGGTTCCCCCATCCTCACCTAGG - Intronic
1172996316 20:39072579-39072601 AGCTGGCCCCCGCTCCCCCTGGG - Intergenic
1173189279 20:40863733-40863755 TGGTGGCCCCAGGCCTTCCTTGG - Intergenic
1173667891 20:44775584-44775606 GGGTGGCCCCAGCCCCGCTGTGG - Intronic
1174357971 20:50010628-50010650 GGGTGGCTCCAGCCCCACCATGG - Intergenic
1174393639 20:50233244-50233266 AGGAGGCCTCAGCCCCAGCCTGG - Intergenic
1175390511 20:58624412-58624434 AGTTGCCCCCATCCCCACCAGGG + Intergenic
1175802678 20:61810122-61810144 AGGTGCCCCCCACCCCACCCCGG - Intronic
1175869220 20:62199936-62199958 ATCTGCCCCCCGCCCCACCTTGG + Intronic
1175900513 20:62358197-62358219 GAGCGGCCCCATCCCCACCTTGG + Intronic
1175955638 20:62607796-62607818 TGGTGGCCCCAGTCCTGCCTTGG + Intergenic
1175971648 20:62689550-62689572 AGGGGACCCCAGCCCCAGCAGGG + Intergenic
1176086520 20:63297733-63297755 AGGCGGACTCAGCCCCACTTGGG - Intronic
1176089919 20:63314229-63314251 AGGTAGACCCAGCCCCAGCCGGG + Intronic
1176260690 20:64177935-64177957 TGCCGGCCCCAGCCCCACCCAGG - Intronic
1176267352 20:64217123-64217145 ACGTGGCCCCCGCCACACCCAGG + Exonic
1177037453 21:16061077-16061099 AGTTGCCCTAAGCCCCACCTCGG + Intergenic
1178016208 21:28348364-28348386 AGTTTACCCCAGGCCCACCTAGG - Intergenic
1178696456 21:34796925-34796947 TCCCGGCCCCAGCCCCACCTGGG - Intronic
1178912621 21:36687816-36687838 TGGTGGCCCCAGGCACTCCTTGG - Intergenic
1178937310 21:36874808-36874830 GGGTGGCCGCAGCTGCACCTGGG - Intronic
1179716423 21:43291050-43291072 CCGTGGCCCCAGCAGCACCTTGG - Intergenic
1179802287 21:43816662-43816684 AGCTGGCCACAGCCCCAGCAGGG + Intergenic
1179886877 21:44317993-44318015 GGCAGGCCCCAGCCCCACCCCGG - Intronic
1180614851 22:17120526-17120548 TGGTAGCCCCAGCGGCACCTGGG + Exonic
1181286141 22:21753867-21753889 ACGTTGGCCCGGCCCCACCTTGG - Intergenic
1181646084 22:24232429-24232451 AGGTGGACCCAGGCCCCACTGGG - Intronic
1182286908 22:29254116-29254138 CGGTGGCCCATGCCCCACCCGGG - Intronic
1182624451 22:31635672-31635694 AGGTGGCCCAGGACCCACCTGGG - Intronic
1183343545 22:37294878-37294900 GGGTGGCCCCGGCCCCATCCCGG + Intronic
1183734474 22:39636239-39636261 AGATGGCCCCAGCCCTGTCTCGG + Intronic
1183750914 22:39719793-39719815 AGGTGGCCCCATCCCCCAGTCGG + Intergenic
1183961514 22:41414210-41414232 AGGGAGCCCCAGCTCCGCCTGGG + Intergenic
1184665608 22:45987353-45987375 GGGCGGCTGCAGCCCCACCTAGG - Intergenic
1184689228 22:46109968-46109990 CTGGGCCCCCAGCCCCACCTGGG - Intronic
1184693224 22:46126748-46126770 AGGTTCCCCCACCCCCACCTTGG + Intergenic
1185272836 22:49936558-49936580 GGGTGCCCCCCGCCCCACCCAGG + Intergenic
953145496 3:40270929-40270951 AGGTGGCCTGAGCCACACCCAGG + Intergenic
953666155 3:44927921-44927943 TGGAGGGCCCTGCCCCACCTGGG - Intronic
954291918 3:49654367-49654389 AGCTGCCCCCAGAGCCACCTGGG + Exonic
954321964 3:49838377-49838399 AGGTGGGCCCGTCCCCAACTGGG + Intronic
954324703 3:49857046-49857068 AGGTCACCCCAGGCCAACCTTGG + Intergenic
954609561 3:51937158-51937180 TGGGGGCTCCAGCCCCACCCAGG + Intronic
954708103 3:52491809-52491831 TGGTGCTCCCAGCCCCACCAGGG + Intronic
955532232 3:59886244-59886266 ATGTGGCCTCAGGCTCACCTGGG - Intronic
960269190 3:115656080-115656102 AGGTAGCCCCAGCTCTATCTGGG + Intronic
960690479 3:120341854-120341876 AGGTGGCTGTAGCCCCACCCAGG - Intronic
961128274 3:124441680-124441702 AGGTGCCCACCGCCACACCTAGG - Intronic
961552356 3:127676644-127676666 AGGTCAGCCCAGCCACACCTAGG - Intronic
961605878 3:128095091-128095113 ATTTGGCCCCAGCCCCATCTGGG - Intronic
963599311 3:147364148-147364170 ATGTGGTCCCAGCATCACCTGGG + Intergenic
965205286 3:165713637-165713659 GGGTGGCTGCAGCCACACCTGGG + Intergenic
966744558 3:183263341-183263363 AGATGGACCCTGCCCCACTTGGG - Intronic
967388416 3:188931790-188931812 AGGAGGCCCGAGCCTCAACTTGG + Intergenic
968441167 4:625220-625242 AGGTGGCCCCAGGCCCTCCTGGG - Intergenic
968580057 4:1385589-1385611 AGGTGGCCCCAGCCCCACCTTGG - Intronic
968869546 4:3234709-3234731 ACGTGGTCCCACCTCCACCTCGG - Intronic
969054845 4:4395213-4395235 AGGTGGCTCCAGAAACACCTGGG - Intronic
969453284 4:7286977-7286999 AGGTGGCTGCAGCCCGGCCTGGG + Intronic
969460312 4:7325549-7325571 AGCTGCCCCCAGCCCCATTTAGG - Intronic
970142362 4:12996437-12996459 AGGAGCCCCCAGCACCACCAGGG + Intergenic
970175774 4:13338085-13338107 AGGTAGCTCCAGGCCCTCCTTGG - Intergenic
970369934 4:15396253-15396275 AGGTTGGCTCAGGCCCACCTTGG - Intronic
972607819 4:40630216-40630238 AAGTGGCACCTGCTCCACCTGGG + Intronic
976693450 4:87893450-87893472 AGGTAGCTCCAGACCCTCCTTGG - Intergenic
977960228 4:103076573-103076595 AGGTGGCGCCAGGCCGACCATGG + Exonic
981580708 4:146246035-146246057 ATGTGGACTCAGCCCGACCTTGG + Intergenic
982211352 4:153039180-153039202 AAGGGGACCCAGCCCCGCCTGGG - Intergenic
984325154 4:178241875-178241897 AGCTGCCCTCAGCCCCTCCTTGG - Intergenic
985524814 5:396408-396430 GGGCGGCCCCAGCCTCACCCTGG + Intronic
985587249 5:746904-746926 ATGTGGCCTCGGCCCAACCTCGG + Intronic
985601799 5:838996-839018 ATGTGGCCTCGGCCCAACCTCGG + Intronic
985668767 5:1195790-1195812 CCCTGGCCCCTGCCCCACCTTGG + Intergenic
985685886 5:1281282-1281304 AAATGGCCCCAGCACCACGTCGG + Intronic
985755018 5:1708730-1708752 AGGCGGCCCCTGCCCCCACTTGG + Intergenic
986694382 5:10339120-10339142 GGATCGCCCCACCCCCACCTTGG + Intergenic
986833621 5:11609758-11609780 AGGTGGCTTCAAACCCACCTGGG - Intronic
987182740 5:15384887-15384909 AGAGCGCCTCAGCCCCACCTGGG + Intergenic
989099636 5:37811914-37811936 AGCTGGCCTCAGCACCACCCTGG + Intergenic
990182981 5:53183125-53183147 CAGTGGCTCCTGCCCCACCTTGG - Intergenic
990639067 5:57761911-57761933 GGGTGGCCGCAGCAGCACCTGGG - Intergenic
993086003 5:83364632-83364654 AGGTGGCAGCATCCCCACTTGGG + Intergenic
993280588 5:85920527-85920549 AGGCCACCCCAGCCCCACCTGGG + Intergenic
994245513 5:97471623-97471645 AGGTGGCTACAGCTGCACCTGGG + Intergenic
996846861 5:127909198-127909220 AATTGGCCCCAGACCCACCTGGG - Intergenic
997259914 5:132457722-132457744 AGGTGGGCCCAGCCCCCCCCAGG - Intronic
998097227 5:139402972-139402994 AGGAGGCCCCAACCCAGCCTGGG + Intronic
998406201 5:141876178-141876200 TGGCGGCCCCACCCCCACCCCGG + Intronic
999282849 5:150376225-150376247 GGGTGCCCCCAGCCACAGCTGGG - Exonic
999376122 5:151087435-151087457 AGGTTGCCCCAGCCCATTCTCGG - Intronic
1000799950 5:165713439-165713461 AGCTGGTGACAGCCCCACCTGGG - Intergenic
1000825465 5:166038619-166038641 AGGTGGCCTCAGCCAGACTTGGG + Intergenic
1002024063 5:176384806-176384828 AGCTGGCCCCAGCTCCTCCCTGG - Intronic
1002524522 5:179807552-179807574 AGGTGGCCCCTACACCACCGGGG - Intronic
1002542333 5:179914515-179914537 GGGTGGTCCCAGCCCCACTCTGG + Intronic
1002606941 5:180389257-180389279 AGCTGGCCCTTCCCCCACCTGGG + Intergenic
1002662986 5:180803547-180803569 AGGTGGACCCAGGCCCACCGAGG + Intronic
1002846254 6:947758-947780 AGGTCCCCCCAGAGCCACCTAGG - Intergenic
1004260080 6:14100464-14100486 AGTGGGCCCCAGCACCATCTGGG - Intergenic
1004897662 6:20164257-20164279 AGGTGACTCCAGGCCCAACTGGG - Intronic
1006106941 6:31722437-31722459 AGGTGCACACAGCCACACCTAGG - Intronic
1007304589 6:40893996-40894018 AGGAGGCCCCATTCCCTCCTGGG - Intergenic
1007310720 6:40944130-40944152 TGGTGACTCCAGCCCCATCTGGG + Intergenic
1007415995 6:41691584-41691606 AGGTGGGCCCAGCCTATCCTGGG + Intronic
1007500900 6:42296096-42296118 ACGCAGCCCCAGCCCCACCACGG + Intronic
1007596383 6:43053601-43053623 AGGTGGCCAGAGCCCCACCGCGG - Intronic
1007627439 6:43254498-43254520 TGGGGGCCCCAACCCCAGCTGGG - Intronic
1007665648 6:43511411-43511433 AGCTGGCCCCAGTACCACCAAGG + Intronic
1008076329 6:47149731-47149753 AGCTGCCCCAAGCCCCATCTTGG + Intergenic
1009847010 6:69146538-69146560 GGGTGGCCACAGACACACCTGGG + Intronic
1012889893 6:104885820-104885842 AGCTGCCCTCAGCCCCACCTTGG - Intergenic
1013692917 6:112667289-112667311 AGGAGGCTGCAGCCCCACCCAGG - Intergenic
1013850268 6:114505184-114505206 AATTGGCCCAAGCCGCACCTGGG + Intergenic
1014874273 6:126637686-126637708 AGGTGGGCCCAGCCTCGCTTGGG - Intergenic
1016953940 6:149608518-149608540 TTGTGGCCCCGGCCCCACCCAGG + Intronic
1017028416 6:150200602-150200624 AGGAGGCCACAGCTGCACCTAGG - Intronic
1017725709 6:157274832-157274854 AGGCGGCGACAGCCCCGCCTAGG + Intergenic
1017905645 6:158756133-158756155 AGGTGGAGTCAGCCACACCTTGG + Intronic
1017911461 6:158796428-158796450 GGGTGGCCCCAGCCTCACTCAGG + Intronic
1017915941 6:158831743-158831765 AGTTAGCACCTGCCCCACCTAGG - Intergenic
1018625130 6:165770853-165770875 AGGTGGCCCCGGGAGCACCTGGG - Intronic
1018723449 6:166591603-166591625 TGGTGGCCCCAGGCACTCCTTGG - Intronic
1019428304 7:987527-987549 AGGGAGGCCCAGCCCCACCTTGG - Exonic
1019705766 7:2496538-2496560 AGGTGTCCCCGCCCCCACCTTGG + Intergenic
1020111519 7:5450743-5450765 AGGTGCCCTCAGAGCCACCTAGG - Intronic
1020140461 7:5608737-5608759 TAGTGGCCCCCGACCCACCTGGG - Intergenic
1020140654 7:5609727-5609749 AGGAAGCCCCAGACCCAGCTGGG + Intergenic
1020333935 7:7047065-7047087 AGGCAGCACCAGCACCACCTGGG - Intergenic
1022529476 7:31057955-31057977 AGATGGCCCCAGCCCCATGATGG + Intronic
1023021974 7:36018986-36019008 AGGTACCCCCCGCCCCACCAAGG - Intergenic
1023032113 7:36098894-36098916 AGGTGTCCCCACAACCACCTTGG - Intergenic
1023382669 7:39623850-39623872 GGGTGGCCCCAGTCCCTCCCCGG - Intronic
1023790593 7:43750202-43750224 GGGTGGCTGCAGCCCCACCCAGG + Intergenic
1024057847 7:45676814-45676836 CTGTGGCCCCAGCTCCACCCAGG - Intronic
1024064486 7:45721111-45721133 AGGTGGCCCCTCCACCACTTGGG - Exonic
1024248513 7:47488791-47488813 AGGAGCCCCCGGCCTCACCTGGG - Intronic
1025850335 7:65239127-65239149 AGGGTGCCCCAGGCCCGCCTTGG - Intergenic
1026883322 7:73921028-73921050 ACGCGGCCTCAGCCCCGCCTGGG - Intergenic
1026941616 7:74290511-74290533 CGCAGGCCCCAGCCCCACCCTGG + Intronic
1030533260 7:110736105-110736127 GGGTGGCCCAAGCTGCACCTGGG - Intronic
1031964117 7:128015141-128015163 AGATGGCCCCAGCCATACCCAGG + Intronic
1032128091 7:129209171-129209193 AGTTCACCCCAGCCCCAGCTGGG + Intronic
1032238306 7:130142423-130142445 GGGTGGCCTCCGCCCCTCCTGGG + Intergenic
1035099170 7:156382361-156382383 AGGGGACCCCAGCACCAACTCGG - Intergenic
1035719173 8:1778558-1778580 AGGTGGCCCCAACCACAGGTGGG + Intronic
1037754694 8:21703283-21703305 AGGTGGCCCCCTCCTCCCCTAGG - Intronic
1037833950 8:22205299-22205321 CTGTGGCTCCAGCCTCACCTGGG - Intronic
1039494717 8:37972324-37972346 AGGTGGCACCAGCCACAGCCTGG - Intergenic
1040546510 8:48402140-48402162 AGCTGGCAACAGCCCCACCAAGG + Intergenic
1042856576 8:73273517-73273539 AGCTGCCCTCAGCCCCACCTCGG - Intergenic
1044259297 8:90098605-90098627 GGGTGGCCGCAGCCGCACCTGGG + Intergenic
1046395315 8:113632955-113632977 AGCTGTCCGCATCCCCACCTTGG + Intergenic
1047785680 8:128151945-128151967 CAGTGGCCACAGCCCCACTTGGG - Intergenic
1049190781 8:141286193-141286215 GGGTGCCCACAGCCCCTCCTCGG + Intronic
1049251827 8:141593354-141593376 AGGTGCCCTCAGCCACACCTGGG - Intergenic
1049344863 8:142133450-142133472 AGCTGTCCCCACCCCCACCCGGG - Intergenic
1049529909 8:143149007-143149029 CGGTGGCCCCTGCTCCTCCTGGG - Intergenic
1049826883 8:144674727-144674749 AGCTGCCCTCAGCCCCTCCTCGG + Intergenic
1050918000 9:11161915-11161937 AAGTGGCCCAAGCCACATCTGGG - Intergenic
1052708048 9:32016586-32016608 AGGTGGCTGCAGCTGCACCTGGG + Intergenic
1053001293 9:34578437-34578459 AGGAGGCCCCGGCCACCCCTGGG - Intronic
1055709587 9:79045451-79045473 AGGTGGACCCTCCTCCACCTGGG + Intergenic
1055863399 9:80782546-80782568 AGCCGACCCCAGCTCCACCTGGG + Intergenic
1056703417 9:88931169-88931191 AGGTACCCCTAGCCCCACCAGGG - Intergenic
1056887834 9:90460583-90460605 AGATGGACCCAGGCCCACCCTGG + Intergenic
1057652666 9:96931921-96931943 TGGAAGCCCCAGCCCCACTTGGG - Exonic
1059353617 9:113683466-113683488 AGGCTCCCCCAGCCCCACCACGG + Intergenic
1060880797 9:127116698-127116720 AGTTGGCACCAGGGCCACCTTGG + Intronic
1061626907 9:131845955-131845977 AGGGGGCCCCAGCCCCGGCTGGG + Intergenic
1061954086 9:133952753-133952775 TGGTGGCCCCAGGCACTCCTTGG - Intronic
1062052539 9:134455067-134455089 AGGGGGGCCCAGCCACGCCTCGG - Intergenic
1062097050 9:134708894-134708916 GGGTGGCCCCAGACACTCCTTGG + Intronic
1062210249 9:135359767-135359789 GGGTGGCCCCAGACACTCCTTGG - Intergenic
1062662503 9:137645751-137645773 ACGTGGCTGCAGCCCCACGTGGG + Intronic
1203776859 EBV:78080-78102 AAATGCCACCAGCCCCACCTTGG - Intergenic
1203776877 EBV:78143-78165 AAATGCCACCAGCCCCACCTTGG - Intergenic
1203776893 EBV:78206-78228 AAATGCCACCAGCCCCACCTTGG - Intergenic
1186496721 X:10016452-10016474 AGGTGTCCCCAGCCCCGCGGTGG + Intronic
1187027593 X:15452103-15452125 AGGAGGCCTCAGCCCCACTGGGG - Intronic
1190062774 X:47221790-47221812 GGGTGGCCCCTACCCCTCCTGGG + Intronic
1191202011 X:57793402-57793424 AGGTGGCCCAAAACACACCTAGG + Intergenic
1193283727 X:79686687-79686709 ATGTGTCCCCATCCCCACATTGG + Intergenic
1197113003 X:122798174-122798196 AGGTCTCCCCAGCCCCAGGTGGG - Intergenic
1197796033 X:130299550-130299572 AGCTGCCCCCAGCCCCATCTTGG + Intergenic
1199847332 X:151700801-151700823 ACTGGGCCCCAGCACCACCTGGG - Exonic
1200089355 X:153627091-153627113 AGGTCGCCCCAGCCCCCACCAGG - Intergenic
1200687168 Y:6266998-6267020 TGGAGGCACAAGCCCCACCTAGG + Intergenic