ID: 968585673

View in Genome Browser
Species Human (GRCh38)
Location 4:1414897-1414919
Sequence TCTGGGGGGAGGGCAGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968585673_968585682 2 Left 968585673 4:1414897-1414919 CCCGCAGCTGCCCTCCCCCCAGA No data
Right 968585682 4:1414922-1414944 AGCGCCCGCCCCCCTCCTCTCGG No data
968585673_968585688 10 Left 968585673 4:1414897-1414919 CCCGCAGCTGCCCTCCCCCCAGA No data
Right 968585688 4:1414930-1414952 CCCCCCTCCTCTCGGCGGTTGGG No data
968585673_968585693 16 Left 968585673 4:1414897-1414919 CCCGCAGCTGCCCTCCCCCCAGA No data
Right 968585693 4:1414936-1414958 TCCTCTCGGCGGTTGGGAGCCGG No data
968585673_968585683 5 Left 968585673 4:1414897-1414919 CCCGCAGCTGCCCTCCCCCCAGA No data
Right 968585683 4:1414925-1414947 GCCCGCCCCCCTCCTCTCGGCGG No data
968585673_968585686 9 Left 968585673 4:1414897-1414919 CCCGCAGCTGCCCTCCCCCCAGA No data
Right 968585686 4:1414929-1414951 GCCCCCCTCCTCTCGGCGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968585673 Original CRISPR TCTGGGGGGAGGGCAGCTGC GGG (reversed) Intergenic
No off target data available for this crispr