ID: 968591618

View in Genome Browser
Species Human (GRCh38)
Location 4:1462509-1462531
Sequence CAGTGTCTCGGGGCCTTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968591618_968591622 -8 Left 968591618 4:1462509-1462531 CCAGGGAAGGCCCCGAGACACTG No data
Right 968591622 4:1462524-1462546 AGACACTGTGTTCCAGCCACAGG No data
968591618_968591623 -7 Left 968591618 4:1462509-1462531 CCAGGGAAGGCCCCGAGACACTG No data
Right 968591623 4:1462525-1462547 GACACTGTGTTCCAGCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968591618 Original CRISPR CAGTGTCTCGGGGCCTTCCC TGG (reversed) Intergenic
No off target data available for this crispr