ID: 968593731

View in Genome Browser
Species Human (GRCh38)
Location 4:1472205-1472227
Sequence CCCGTGTCCCGCGGGGCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968593720_968593731 16 Left 968593720 4:1472166-1472188 CCCGTTATCGCGCCTGACGGGTG No data
Right 968593731 4:1472205-1472227 CCCGTGTCCCGCGGGGCAGCCGG No data
968593717_968593731 21 Left 968593717 4:1472161-1472183 CCGCGCCCGTTATCGCGCCTGAC No data
Right 968593731 4:1472205-1472227 CCCGTGTCCCGCGGGGCAGCCGG No data
968593721_968593731 15 Left 968593721 4:1472167-1472189 CCGTTATCGCGCCTGACGGGTGT No data
Right 968593731 4:1472205-1472227 CCCGTGTCCCGCGGGGCAGCCGG No data
968593723_968593731 4 Left 968593723 4:1472178-1472200 CCTGACGGGTGTCAGCGGCCACC No data
Right 968593731 4:1472205-1472227 CCCGTGTCCCGCGGGGCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968593731 Original CRISPR CCCGTGTCCCGCGGGGCAGC CGG Intergenic
No off target data available for this crispr