ID: 968593878

View in Genome Browser
Species Human (GRCh38)
Location 4:1472699-1472721
Sequence TCCTCCTCAGGTGGCCACGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968593864_968593878 21 Left 968593864 4:1472655-1472677 CCTGCCCGGCTGCTCCTCCACCT No data
Right 968593878 4:1472699-1472721 TCCTCCTCAGGTGGCCACGCCGG No data
968593868_968593878 7 Left 968593868 4:1472669-1472691 CCTCCACCTCCTCTTTTGGACCG No data
Right 968593878 4:1472699-1472721 TCCTCCTCAGGTGGCCACGCCGG No data
968593872_968593878 1 Left 968593872 4:1472675-1472697 CCTCCTCTTTTGGACCGGGAAGG No data
Right 968593878 4:1472699-1472721 TCCTCCTCAGGTGGCCACGCCGG No data
968593865_968593878 17 Left 968593865 4:1472659-1472681 CCCGGCTGCTCCTCCACCTCCTC No data
Right 968593878 4:1472699-1472721 TCCTCCTCAGGTGGCCACGCCGG No data
968593862_968593878 25 Left 968593862 4:1472651-1472673 CCACCCTGCCCGGCTGCTCCTCC No data
Right 968593878 4:1472699-1472721 TCCTCCTCAGGTGGCCACGCCGG No data
968593863_968593878 22 Left 968593863 4:1472654-1472676 CCCTGCCCGGCTGCTCCTCCACC No data
Right 968593878 4:1472699-1472721 TCCTCCTCAGGTGGCCACGCCGG No data
968593871_968593878 4 Left 968593871 4:1472672-1472694 CCACCTCCTCTTTTGGACCGGGA No data
Right 968593878 4:1472699-1472721 TCCTCCTCAGGTGGCCACGCCGG No data
968593861_968593878 26 Left 968593861 4:1472650-1472672 CCCACCCTGCCCGGCTGCTCCTC No data
Right 968593878 4:1472699-1472721 TCCTCCTCAGGTGGCCACGCCGG No data
968593874_968593878 -2 Left 968593874 4:1472678-1472700 CCTCTTTTGGACCGGGAAGGCTC No data
Right 968593878 4:1472699-1472721 TCCTCCTCAGGTGGCCACGCCGG No data
968593866_968593878 16 Left 968593866 4:1472660-1472682 CCGGCTGCTCCTCCACCTCCTCT No data
Right 968593878 4:1472699-1472721 TCCTCCTCAGGTGGCCACGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968593878 Original CRISPR TCCTCCTCAGGTGGCCACGC CGG Intergenic