ID: 968595396

View in Genome Browser
Species Human (GRCh38)
Location 4:1479649-1479671
Sequence CGCTGGAGACGGGCACGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968595396_968595399 -8 Left 968595396 4:1479649-1479671 CCAGCACGTGCCCGTCTCCAGCG No data
Right 968595399 4:1479664-1479686 CTCCAGCGCCGATGCTGTAATGG No data
968595396_968595404 6 Left 968595396 4:1479649-1479671 CCAGCACGTGCCCGTCTCCAGCG No data
Right 968595404 4:1479678-1479700 CTGTAATGGGTGGACCCAGATGG No data
968595396_968595408 19 Left 968595396 4:1479649-1479671 CCAGCACGTGCCCGTCTCCAGCG No data
Right 968595408 4:1479691-1479713 ACCCAGATGGTGACCTGGAGGGG No data
968595396_968595407 18 Left 968595396 4:1479649-1479671 CCAGCACGTGCCCGTCTCCAGCG No data
Right 968595407 4:1479690-1479712 GACCCAGATGGTGACCTGGAGGG No data
968595396_968595410 20 Left 968595396 4:1479649-1479671 CCAGCACGTGCCCGTCTCCAGCG No data
Right 968595410 4:1479692-1479714 CCCAGATGGTGACCTGGAGGGGG No data
968595396_968595405 14 Left 968595396 4:1479649-1479671 CCAGCACGTGCCCGTCTCCAGCG No data
Right 968595405 4:1479686-1479708 GGTGGACCCAGATGGTGACCTGG No data
968595396_968595400 -7 Left 968595396 4:1479649-1479671 CCAGCACGTGCCCGTCTCCAGCG No data
Right 968595400 4:1479665-1479687 TCCAGCGCCGATGCTGTAATGGG No data
968595396_968595406 17 Left 968595396 4:1479649-1479671 CCAGCACGTGCCCGTCTCCAGCG No data
Right 968595406 4:1479689-1479711 GGACCCAGATGGTGACCTGGAGG No data
968595396_968595402 -4 Left 968595396 4:1479649-1479671 CCAGCACGTGCCCGTCTCCAGCG No data
Right 968595402 4:1479668-1479690 AGCGCCGATGCTGTAATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968595396 Original CRISPR CGCTGGAGACGGGCACGTGC TGG (reversed) Intergenic