ID: 968595397

View in Genome Browser
Species Human (GRCh38)
Location 4:1479659-1479681
Sequence ACAGCATCGGCGCTGGAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968595397_968595406 7 Left 968595397 4:1479659-1479681 CCCGTCTCCAGCGCCGATGCTGT No data
Right 968595406 4:1479689-1479711 GGACCCAGATGGTGACCTGGAGG No data
968595397_968595410 10 Left 968595397 4:1479659-1479681 CCCGTCTCCAGCGCCGATGCTGT No data
Right 968595410 4:1479692-1479714 CCCAGATGGTGACCTGGAGGGGG No data
968595397_968595413 23 Left 968595397 4:1479659-1479681 CCCGTCTCCAGCGCCGATGCTGT No data
Right 968595413 4:1479705-1479727 CTGGAGGGGGTGCTGCAGCCAGG No data
968595397_968595408 9 Left 968595397 4:1479659-1479681 CCCGTCTCCAGCGCCGATGCTGT No data
Right 968595408 4:1479691-1479713 ACCCAGATGGTGACCTGGAGGGG No data
968595397_968595407 8 Left 968595397 4:1479659-1479681 CCCGTCTCCAGCGCCGATGCTGT No data
Right 968595407 4:1479690-1479712 GACCCAGATGGTGACCTGGAGGG No data
968595397_968595404 -4 Left 968595397 4:1479659-1479681 CCCGTCTCCAGCGCCGATGCTGT No data
Right 968595404 4:1479678-1479700 CTGTAATGGGTGGACCCAGATGG No data
968595397_968595405 4 Left 968595397 4:1479659-1479681 CCCGTCTCCAGCGCCGATGCTGT No data
Right 968595405 4:1479686-1479708 GGTGGACCCAGATGGTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968595397 Original CRISPR ACAGCATCGGCGCTGGAGAC GGG (reversed) Intergenic