ID: 968595398

View in Genome Browser
Species Human (GRCh38)
Location 4:1479660-1479682
Sequence TACAGCATCGGCGCTGGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968595398_968595407 7 Left 968595398 4:1479660-1479682 CCGTCTCCAGCGCCGATGCTGTA No data
Right 968595407 4:1479690-1479712 GACCCAGATGGTGACCTGGAGGG No data
968595398_968595404 -5 Left 968595398 4:1479660-1479682 CCGTCTCCAGCGCCGATGCTGTA No data
Right 968595404 4:1479678-1479700 CTGTAATGGGTGGACCCAGATGG No data
968595398_968595408 8 Left 968595398 4:1479660-1479682 CCGTCTCCAGCGCCGATGCTGTA No data
Right 968595408 4:1479691-1479713 ACCCAGATGGTGACCTGGAGGGG No data
968595398_968595405 3 Left 968595398 4:1479660-1479682 CCGTCTCCAGCGCCGATGCTGTA No data
Right 968595405 4:1479686-1479708 GGTGGACCCAGATGGTGACCTGG No data
968595398_968595413 22 Left 968595398 4:1479660-1479682 CCGTCTCCAGCGCCGATGCTGTA No data
Right 968595413 4:1479705-1479727 CTGGAGGGGGTGCTGCAGCCAGG No data
968595398_968595410 9 Left 968595398 4:1479660-1479682 CCGTCTCCAGCGCCGATGCTGTA No data
Right 968595410 4:1479692-1479714 CCCAGATGGTGACCTGGAGGGGG No data
968595398_968595406 6 Left 968595398 4:1479660-1479682 CCGTCTCCAGCGCCGATGCTGTA No data
Right 968595406 4:1479689-1479711 GGACCCAGATGGTGACCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968595398 Original CRISPR TACAGCATCGGCGCTGGAGA CGG (reversed) Intergenic