ID: 968595399 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:1479664-1479686 |
Sequence | CTCCAGCGCCGATGCTGTAA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
968595396_968595399 | -8 | Left | 968595396 | 4:1479649-1479671 | CCAGCACGTGCCCGTCTCCAGCG | No data | ||
Right | 968595399 | 4:1479664-1479686 | CTCCAGCGCCGATGCTGTAATGG | No data | ||||
968595393_968595399 | 29 | Left | 968595393 | 4:1479612-1479634 | CCTTCAGTGGAATAGAGAAGAGT | No data | ||
Right | 968595399 | 4:1479664-1479686 | CTCCAGCGCCGATGCTGTAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
968595399 | Original CRISPR | CTCCAGCGCCGATGCTGTAA TGG | Intergenic | ||