ID: 968595400 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:1479665-1479687 |
Sequence | TCCAGCGCCGATGCTGTAAT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
968595393_968595400 | 30 | Left | 968595393 | 4:1479612-1479634 | CCTTCAGTGGAATAGAGAAGAGT | No data | ||
Right | 968595400 | 4:1479665-1479687 | TCCAGCGCCGATGCTGTAATGGG | No data | ||||
968595396_968595400 | -7 | Left | 968595396 | 4:1479649-1479671 | CCAGCACGTGCCCGTCTCCAGCG | No data | ||
Right | 968595400 | 4:1479665-1479687 | TCCAGCGCCGATGCTGTAATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
968595400 | Original CRISPR | TCCAGCGCCGATGCTGTAAT GGG | Intergenic | ||