ID: 968595401

View in Genome Browser
Species Human (GRCh38)
Location 4:1479666-1479688
Sequence ACCCATTACAGCATCGGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968595401_968595410 3 Left 968595401 4:1479666-1479688 CCAGCGCCGATGCTGTAATGGGT No data
Right 968595410 4:1479692-1479714 CCCAGATGGTGACCTGGAGGGGG No data
968595401_968595408 2 Left 968595401 4:1479666-1479688 CCAGCGCCGATGCTGTAATGGGT No data
Right 968595408 4:1479691-1479713 ACCCAGATGGTGACCTGGAGGGG No data
968595401_968595407 1 Left 968595401 4:1479666-1479688 CCAGCGCCGATGCTGTAATGGGT No data
Right 968595407 4:1479690-1479712 GACCCAGATGGTGACCTGGAGGG No data
968595401_968595413 16 Left 968595401 4:1479666-1479688 CCAGCGCCGATGCTGTAATGGGT No data
Right 968595413 4:1479705-1479727 CTGGAGGGGGTGCTGCAGCCAGG No data
968595401_968595405 -3 Left 968595401 4:1479666-1479688 CCAGCGCCGATGCTGTAATGGGT No data
Right 968595405 4:1479686-1479708 GGTGGACCCAGATGGTGACCTGG No data
968595401_968595406 0 Left 968595401 4:1479666-1479688 CCAGCGCCGATGCTGTAATGGGT No data
Right 968595406 4:1479689-1479711 GGACCCAGATGGTGACCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968595401 Original CRISPR ACCCATTACAGCATCGGCGC TGG (reversed) Intergenic