ID: 968595402 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:1479668-1479690 |
| Sequence | AGCGCCGATGCTGTAATGGG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 968595396_968595402 | -4 | Left | 968595396 | 4:1479649-1479671 | CCAGCACGTGCCCGTCTCCAGCG | No data | ||
| Right | 968595402 | 4:1479668-1479690 | AGCGCCGATGCTGTAATGGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 968595402 | Original CRISPR | AGCGCCGATGCTGTAATGGG TGG | Intergenic | ||