ID: 968595406

View in Genome Browser
Species Human (GRCh38)
Location 4:1479689-1479711
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968595396_968595406 17 Left 968595396 4:1479649-1479671 CCAGCACGTGCCCGTCTCCAGCG No data
Right 968595406 4:1479689-1479711 GGACCCAGATGGTGACCTGGAGG No data
968595397_968595406 7 Left 968595397 4:1479659-1479681 CCCGTCTCCAGCGCCGATGCTGT No data
Right 968595406 4:1479689-1479711 GGACCCAGATGGTGACCTGGAGG No data
968595403_968595406 -6 Left 968595403 4:1479672-1479694 CCGATGCTGTAATGGGTGGACCC No data
Right 968595406 4:1479689-1479711 GGACCCAGATGGTGACCTGGAGG No data
968595401_968595406 0 Left 968595401 4:1479666-1479688 CCAGCGCCGATGCTGTAATGGGT No data
Right 968595406 4:1479689-1479711 GGACCCAGATGGTGACCTGGAGG No data
968595398_968595406 6 Left 968595398 4:1479660-1479682 CCGTCTCCAGCGCCGATGCTGTA No data
Right 968595406 4:1479689-1479711 GGACCCAGATGGTGACCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr