ID: 968595988

View in Genome Browser
Species Human (GRCh38)
Location 4:1485283-1485305
Sequence CTCAGTGCTTTGAGAGGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44118
Summary {0: 3, 1: 49, 2: 571, 3: 5105, 4: 38390}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968595988_968595991 4 Left 968595988 4:1485283-1485305 CCTTAGCCTCTCAAAGCACTGAG 0: 3
1: 49
2: 571
3: 5105
4: 38390
Right 968595991 4:1485310-1485332 GAGGTGTGAGCCACCATGCCTGG 0: 70
1: 7109
2: 31709
3: 86375
4: 164532

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968595988 Original CRISPR CTCAGTGCTTTGAGAGGCTA AGG (reversed) Intergenic
Too many off-targets to display for this crispr