ID: 968595988 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:1485283-1485305 |
| Sequence | CTCAGTGCTTTGAGAGGCTA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 44118 | |||
| Summary | {0: 3, 1: 49, 2: 571, 3: 5105, 4: 38390} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 968595988_968595991 | 4 | Left | 968595988 | 4:1485283-1485305 | CCTTAGCCTCTCAAAGCACTGAG | 0: 3 1: 49 2: 571 3: 5105 4: 38390 |
||
| Right | 968595991 | 4:1485310-1485332 | GAGGTGTGAGCCACCATGCCTGG | 0: 70 1: 7109 2: 31709 3: 86375 4: 164532 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 968595988 | Original CRISPR | CTCAGTGCTTTGAGAGGCTA AGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||