ID: 968597212

View in Genome Browser
Species Human (GRCh38)
Location 4:1491717-1491739
Sequence GACTCAGCTGTGCCACCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968597208_968597212 23 Left 968597208 4:1491671-1491693 CCTGGGGAAGGAGTGGGGCTTCA No data
Right 968597212 4:1491717-1491739 GACTCAGCTGTGCCACCATCAGG No data
968597207_968597212 26 Left 968597207 4:1491668-1491690 CCACCTGGGGAAGGAGTGGGGCT No data
Right 968597212 4:1491717-1491739 GACTCAGCTGTGCCACCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968597212 Original CRISPR GACTCAGCTGTGCCACCATC AGG Intergenic
No off target data available for this crispr