ID: 968597318

View in Genome Browser
Species Human (GRCh38)
Location 4:1492147-1492169
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968597318_968597322 3 Left 968597318 4:1492147-1492169 CCTGTTACCAGCAGCACAGGGGC No data
Right 968597322 4:1492173-1492195 GCAGTGCCTCTGTCTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968597318 Original CRISPR GCCCCTGTGCTGCTGGTAAC AGG (reversed) Intergenic
No off target data available for this crispr