ID: 968600860

View in Genome Browser
Species Human (GRCh38)
Location 4:1508655-1508677
Sequence GCTGCTGGGGCCACACACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968600860_968600869 2 Left 968600860 4:1508655-1508677 CCCAGGTGTGTGGCCCCAGCAGC No data
Right 968600869 4:1508680-1508702 TGGCACGGGTATCTGGCCAGTGG No data
968600860_968600871 18 Left 968600860 4:1508655-1508677 CCCAGGTGTGTGGCCCCAGCAGC No data
Right 968600871 4:1508696-1508718 CCAGTGGCCCTGACCCAGCCTGG No data
968600860_968600868 -5 Left 968600860 4:1508655-1508677 CCCAGGTGTGTGGCCCCAGCAGC No data
Right 968600868 4:1508673-1508695 GCAGCTGTGGCACGGGTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968600860 Original CRISPR GCTGCTGGGGCCACACACCT GGG (reversed) Intergenic
No off target data available for this crispr