ID: 968600869

View in Genome Browser
Species Human (GRCh38)
Location 4:1508680-1508702
Sequence TGGCACGGGTATCTGGCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968600851_968600869 30 Left 968600851 4:1508627-1508649 CCCAGGCTCATGGGGGAGCCTCC No data
Right 968600869 4:1508680-1508702 TGGCACGGGTATCTGGCCAGTGG No data
968600860_968600869 2 Left 968600860 4:1508655-1508677 CCCAGGTGTGTGGCCCCAGCAGC No data
Right 968600869 4:1508680-1508702 TGGCACGGGTATCTGGCCAGTGG No data
968600861_968600869 1 Left 968600861 4:1508656-1508678 CCAGGTGTGTGGCCCCAGCAGCT No data
Right 968600869 4:1508680-1508702 TGGCACGGGTATCTGGCCAGTGG No data
968600857_968600869 12 Left 968600857 4:1508645-1508667 CCTCCTGGGGCCCAGGTGTGTGG No data
Right 968600869 4:1508680-1508702 TGGCACGGGTATCTGGCCAGTGG No data
968600852_968600869 29 Left 968600852 4:1508628-1508650 CCAGGCTCATGGGGGAGCCTCCT No data
Right 968600869 4:1508680-1508702 TGGCACGGGTATCTGGCCAGTGG No data
968600859_968600869 9 Left 968600859 4:1508648-1508670 CCTGGGGCCCAGGTGTGTGGCCC No data
Right 968600869 4:1508680-1508702 TGGCACGGGTATCTGGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968600869 Original CRISPR TGGCACGGGTATCTGGCCAG TGG Intergenic
No off target data available for this crispr