ID: 968600871

View in Genome Browser
Species Human (GRCh38)
Location 4:1508696-1508718
Sequence CCAGTGGCCCTGACCCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968600859_968600871 25 Left 968600859 4:1508648-1508670 CCTGGGGCCCAGGTGTGTGGCCC No data
Right 968600871 4:1508696-1508718 CCAGTGGCCCTGACCCAGCCTGG No data
968600861_968600871 17 Left 968600861 4:1508656-1508678 CCAGGTGTGTGGCCCCAGCAGCT No data
Right 968600871 4:1508696-1508718 CCAGTGGCCCTGACCCAGCCTGG No data
968600860_968600871 18 Left 968600860 4:1508655-1508677 CCCAGGTGTGTGGCCCCAGCAGC No data
Right 968600871 4:1508696-1508718 CCAGTGGCCCTGACCCAGCCTGG No data
968600865_968600871 5 Left 968600865 4:1508668-1508690 CCCCAGCAGCTGTGGCACGGGTA No data
Right 968600871 4:1508696-1508718 CCAGTGGCCCTGACCCAGCCTGG No data
968600866_968600871 4 Left 968600866 4:1508669-1508691 CCCAGCAGCTGTGGCACGGGTAT No data
Right 968600871 4:1508696-1508718 CCAGTGGCCCTGACCCAGCCTGG No data
968600857_968600871 28 Left 968600857 4:1508645-1508667 CCTCCTGGGGCCCAGGTGTGTGG No data
Right 968600871 4:1508696-1508718 CCAGTGGCCCTGACCCAGCCTGG No data
968600867_968600871 3 Left 968600867 4:1508670-1508692 CCAGCAGCTGTGGCACGGGTATC No data
Right 968600871 4:1508696-1508718 CCAGTGGCCCTGACCCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968600871 Original CRISPR CCAGTGGCCCTGACCCAGCC TGG Intergenic
No off target data available for this crispr